gate.io/signup/612995 Essay Samples and Topics Online

Annotated Bibliography

4 pages (1000 words) , Download 2 , Admission/Application Essay

This can help in formulating an idea of how stress impacts college students which is consistent with their assessment of the.... ... ... The book is also a credible academic resource which can be trusted with the information it provides.... The book addresses the degree of stress experienced during childhood and adulthood and how this can be coped through various methods. ...

Preview sample

Michigan Liquor Control Commission

4 pages (1000 words) , Download 2 , Research Paper

The transfer costs are likely to reduce because of the high traffic flow.... The customers may benefit from economies of scale by having more.... ... ... The POS driven information system gives and accurate inventory management at the store.... Forward buying will be reduced because the manufacturer knows the precise quantity available at the retailers (Bowersox et al, 2007)....

Preview sample

Militarization and Police Brutality

4 pages (1000 words) , Download 3 , Annotated Bibliography

Free

This article 'Militarization and Police Brutality' examines the correlation between the militarization of police and the overall level of violence that these so-called 'peace officers' are willing to direct the average citizen.... ... ... ... The author indicates that even though it might seem as a trivial matter, the actual clothing and tactical weapons that police are now receiving has had a direct correlation to the overall level of violence that they are comfortable with directing at the citizen....

Preview sample

The Impact of Outdoor Air Pollution

3 pages (750 words) , Download 6 , Research Proposal

This kind of pollution normally posses harm to humans thus, it is a critical topic worth highlighting.... Since, in exploring this subject may result into finding remedies to the adverse effects thus turning to be.... ... ... Outdoor air pollution is usually due to small particles from car exhaust, smoke, dust, factory emissions or even pollen during pollination....

Preview sample

Drones for Domestic Video Surveillance

4 pages (1000 words) , Download 2 , Research Paper

Drones, sometimes known as unmanned aerial vehicles (UAVs) are remotely controlled electronic gadgets that look like small planes or helicopters have grown progressively in the recent past.... The devices that have increasingly become smaller are used to observe activity while.... ... ... The drones are believed to make society safer by providing better perspective and evidence although their use for specific missions must be carefully regulated....

Preview sample

Strategic Management and Strategic Competitiveness

4 pages (1000 words) , Download 2 , Essay

John S.... Pemberton.... Curiosity led him to produce a unique tasting soft drink to be put on sale at soda fountains.... He produced flavored syrup and took it to the neighboring pharmacy to be combined with.... ... ... Frank M.... Robinson, Dr.... Pemberton and the bookkeeper credited the beverage by the name Coca-cola, which is still used today (Lopez, 2012)....

Preview sample

Celia Cruz

4 pages (1000 words) , Download 2 , Research Paper

She received an award of the National Medal of Arts.... Cruz was a Cuban singer who was celebrated internationally for many years as the Queen of Salsa.... ... ... During her performances, she thrilled her audience with her soulful voice and rhythmically compelling style on stage.... Cruz grew up in the district of Havana, in an extended family of fourteen....

Preview sample

DP Plannning Grid

4 pages (1000 words) , Download 2 , Assignment

Free

The author concludes that nursing is a profession that demands lots of dedication and a comparatively advanced level of knowledge and skills.... The challenges faced by nurses in the contemporary world can only be addressed by having nurses who are equipped with pertinent skills and competencies....

Preview sample

Tools For Learning

4 pages (1000 words) , Download 2 , Essay

Creation of conditions that foster learning process in early childhood entails articulation of different facets that denote the success of the learner.... Characteristics and attribute of effective learning such as engagement, motivation, persistence and thinking critically has.... ... ... As students begin their learning process in their early childhood education, these characteristics and attributes must be put in place by the educators and parents in order to facilitate learning....

Preview sample

Use the first of the prompt 1

4 pages (1000 words) , Download 2 , Essay

The primary intention of this essay is to provide a contrast of the views presented by Richard Rodriguez and Andrew Delbanco in context of education, emphasizing its true and perceived meaning as well as purpose.... Correspondingly, the discussion hereunder emphasizes Rodriguez'.... ... ... It is in this context that the discussion argues on the differences in attitudes of both Rodriguez and Delbanco and provides a relevant justification with reference to the views of these Furthermore, the essay also intends to differentiate why or why not the liberal approach has made a difference in Rodriguez's attitudes as compared to Delbanco....

Preview sample

Foreign Policy and the Middle East

4 pages (1000 words) , Download 2 , Essay

The current Middle East policy on United States is one of the most controversial issues in its political circles and this is essentially because of the different approaches proposed by the two main political parties.... The Republicans are of the opinion that the country should.... ... ... For instance, before the withdrawal of American forces from Iraq under the Obama administration, the Republicans proposed that a deal be struck with the Iraqi government ng a permanent American force to remain in the country in so that it could maintain order and secure the gains that many American servicemen had died for....

Preview sample

TV family assignment

4 pages (1000 words) , Download 2 , Essay

On the other hand, ‘House of Payne' is a Family TV show that ran on the TBS between 2006 and 2010.... Despite the two shows being family-oriented.... ... ... shows that feature family themes and are almost similar in the dramatic ways of life that each family experiences, there is a difference in the nature of the portrayal of these dramatic themes, based on the different times that the two family shows were created....

Preview sample

Ban the Burqa By Claire Berlinski

4 pages (1000 words) , Download 2 , Essay

The article, Ban the Burqa written by Claire Berlinski in the National Review Online magazine have contributed to many controversial.... ... ... The rhetorical analysis of this article discusses the purpose of the article, its targeted audience, rhetorical strategies used, diction and style as well as about the logical fallacies accompanying it....

Preview sample

Neurology Clerkship Thesis Chapter 4

4 pages (1000 words) , Download 2 , Thesis

This would help improve the learning experience of medical students.... Medical students need adequate training because of the sensitivity involved in the healthcare industry.... ... ... The paper explores the importance of properly training medical students because they are expected to exhibit strong abilities in a real-life work setting. ...

Preview sample

Critique of Much Ado about Nothing

4 pages (1000 words) , Download 3 , Essay

Free

This paper presents an in-depth and critical analysis of the play.... It does this by looking at its themes, characterization, plot and stylistic devices.... The stories of these couples are used by the author to develop the play and clearly bring out its themes.... ... ... ... Critique of Much Ado about Nothing Much Ado about Nothing refers to a play which was written by the legendary William Shakespeare between the years 1598 and 1599....

Preview sample

Literacy and ESOL Theories and Frameworks

4 pages (1000 words) , Download 3 , Essay

The complexity arises from the concepts such as the relationship between language minority groups and language majority groups, immigration, language status, and language.... ... ... As such, these factors lead to the reference of language-learning institutions as complex.... In the light of these, effective learning and teaching of English requires guiding frameworks and theories....

Preview sample

Eli and Charliecompare and contrast

5 pages (1250 words) , Download 2 , Book Report/Review

Set in the Oregon territory in the 1851, The Sisters brothers is an interesting novel with its plot following the lives of two brothers Eli Sisters and Charlie Sisters.... The author of the novel, Patrick DeWitt develops systematic conflicts that sustain the story to completing.... ... ... ... Charlie and Eli, the lead characters in the novel are brothers....

Preview sample

The End of Normal James K Galbraith

4 pages (1000 words) , Download 2 , Book Report/Review

Free

According to the report, "The End of Normal" presents a challenge to the common views and analyses concerning the economic patterns of the world.... The economic scene experienced a crisis in 2008.... The result was high unemployment, slow growth, chronic deficits, falling home values.... ... ... ...

Preview sample

Venezuela under Hugo Chavez

4 pages (1000 words) , Download 2 , Essay

Free

In the paper 'Venezuela under Hugo Chavez ' the author focuses on activity of Hugo Rafael Frías who was the Venezuelan President and a politician.... He served as a president from 1999 to 2013, when he died.... He was renowned and spearheaded the fifth republic movement.... ... ... ... The author insists that during the duration Venezuela was under Hugo Chávez, it was not a democratic country, though Chávez was not a dictator, he crushed the democracy of the Venezuelan nation....

Preview sample

Writing a protocol for genomic DNA extraction and PCR

4 pages (1000 words) , Download 3 , Lab Report

10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda DNA (0.... μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,.... ... ... The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol ....

Preview sample

Analysis of the Problems of XYZ Company

4 pages (1000 words) , Download 3 , Assignment

Free

The purpose of this paper is to present a report on the problems of XYZ Company.... The problem of the company is that their Information Technology security system is not upgraded as per the market requirement, and the information is not safe.... It analyses solution and alternative of the problems of XYZ company....

Preview sample

Human Resources Manager Salary

4 pages (1000 words) , Download 2 , Research Paper

Free

The author of the current research paper "Human Resources Manager Salary" primarily mentions that the human resources department is one of the most important departments in any organizations.... People are the most important resource of any organization.... ... ... ... HRD takes care of the human resources of an organization....

Preview sample

Journalism and Publicity

3 pages (750 words) , Download 2 , Essay

In the following essay, the writer would like to discuss a few topics related to the theme of journalism and its aspects in regard to publicity, Therefore, in the paper "Journalism and Publicity" examines several particular cases in the history of media and journalism.... ... ... ... MTV Base is the entertainment channel that I have chosen for the purpose of this case....

Preview sample

International Relation

4 pages (1000 words) , Download 2 , Essay

Humans are always in a state of conflict over their own interests, likes and dislikes and very few situations where they coexist.... According to this theoretical depiction, realism is centered on four.... ... ... fferent propositions which are political groupism which indicates that what is considered the most important thing by all states is striving to acquire as much resources as they can accumulate, egoism where the states consider themselves the most important of all actors, ional anarchy where the international systems currently exists under dislikes and power politics which translates to each state surviving though building up of military (Burchill, et al....

Preview sample

Business Model Canvas Report

4 pages (1000 words) , Download 8 , Essay

This data translates to one person in every twelve people having the disease in the year 2014.... In the US, 39 million people have the disease.... Most of the age group that is heavily affected are those between 40-60 years of.... ... ... The percentage of people in this age group with diabetes will rise by about 6% in the next 15 years. ...

Preview sample

Ventilator Acquired Pneumonia

4 pages (1000 words) , Download 2 , Research Paper

Ventilator-associated pneumonia (VAP) is an infection that attacks the lung in the human being who is in breathing support of machines in hospitals (Datta, 2013).... VAP affects persons who are critically ill in intensive care units.... VAP is a primary source of ever-growing illness.... ... ... Its diagnosis varies from one hospital to another, but it requires a modern infiltrate in chest X-rays together with other factors. ...

Preview sample

Product Differentiation

4 pages (1000 words) , Download 2 , Essay

Free

The writer of the essay "Product Differentiation" suggests that increased competition led to the closure of opportunities in the market and many firms stopped producing as more technological advancements generated new.... But there is still close to 40% that is interested in the old technology.... ...

Preview sample

MakerSpaces ( by use PRINCE2 and Design Thinking method )

1 pages (250 words) , Download 3 , Term Paper

Free

The product can represent what the project is delivering and the sequence or order of these deliverables.... During the course we will examine this notion of product development and.... ... ... This form is a simple start to this process and asks you to consider what actual products / services could be provided through the MakerSpaces....

Preview sample

GM ignition switch recall

4 pages (1000 words) , Download 2 , Research Paper

The issue of controversy that surrounded General Motors' GM was the alleged failure to recall the faulty cars for over a decade since their manufacture yet they knew the problem all along.... The alleged problem that caused the recall of the vehicles was a detent plunger, which.... ... ... Based on reports from the survivors and victims' the ignition key fell from its position therefore causing engine shut down which led to the function failure of other installed safety mechanisms powered by the engine....

Preview sample

US History since watergate

4 pages (1000 words) , Download 2 , Essay

One of such reasons is the rising of oil prices, which prompted President Jimmy Carter to acknowledge publicly that he had failed as a head of state.... He acknowledged publicly that.... ... ... Americans were becoming pessimistic about America's future, and this made them disrespect the government, churches, schools and other institution....

Preview sample

Theological Ethics of Hope and Moral Power

6 pages (1500 words) , Download 2 , Essay

Free

This paper 'Theological Ethics of Hope and Moral Power' aims to explore what would be required for a person in my particular life circumstances to become a moral agent in the face of climate change.... The author will present a plan for moral agency in the face of climate change for the next 5-10 years....

Preview sample

Causality and Primary Symptoms of Child Sexual Abuse

4 pages (1000 words) , Download 2 , Assignment

Free

The object of analysis for the purpose of this assignment is child sexual abuse, a legal offense that can be defined as 'the sexual use of a child by an adult for his or her own sexual gratification without consideration of the child's psychosexual development'.... ... ... ... Child sexual abuse can be defined descriptively as 'any act or acts involving sexual molestation or exploitation, including but not limited to incest or rape, or any sexual offense in any degree, sodomy, or unnatural or perverted sexual practice on a child by any parent, adoptive parent, or any other person who has permanent or temporary custody or responsibility of supervising a minor child'....

Preview sample

Portfolio on recruitment and selection

4 pages (1000 words) , Download 3 , Essay

Many people use the terms interchangeably whereas selection comes after recruitment in the process of hiring.... I learnt that an employee has to.... ... ... The course enlightened me on various recruitment channels and selection principles, with interviews being the instruments of selection process....

Preview sample

Using Your Manager Skills

4 pages (1000 words) , Download 2 , Research Paper

In response to a request to analyze the company's need for outside counsel, accusations of the environmental group against the company are hereby assessed.... The following report will provide details on the assessment and illustrate that our company does not violate the clean.... ... ... The clean water act prohibits any person from discharging any pollutant in the U....

Preview sample

Take Home Final Exam

4 pages (1000 words) , Download 2 , Case Study

Inclusion is defined as a phenomenon, which represents providing equal rights to every individual irrespective of having physical or psychological disorders.... Several legislations have been established with this notion at the backdrop, such as “Educational Amendment Act of.... ... ... Justifiably, “Educational Amendment Act of 1974” mandated forming, developing and preserving a setting wherein optimal learning of the children could occur....

Preview sample

Maximlianus as conscientious objector

4 pages (1000 words) , Download 2 , Assignment

Free

In the paper 'Maximlianus as conscientious objector' the author analyzes Maximlianus objections to the doings of the Church owing to the suffering that he saw around him.... The repeated demonstrations that he successfully led pointed towards the futility of the Roman Church.... ... ... ... The author states that Maximlianus directly abhorred the idea of special treatment and care given to kings and royalty and negligent behavior to poor laborer....

Preview sample

Optical Properties of Liquid Crystals and LCD Displays

4 pages (1000 words) , Download 3 , Research Paper

Free

The research paper 'Optical Properties of Liquid Crystals and LCD Displays' looks at liquid crystals and LCDs, which have become significantly popular with producers of the products enjoying an immense commercial advantage over its wide application.... ... ... ... The author states that the use and application of the liquid crystals span from nearly 25 years ago and have a wide array of applications....

Preview sample

Systems and Cultural Investigation

5 pages (1250 words) , Download 2 , Essay

These are groups of the clinicians and medical staffs that are working together with a common clinical objective to provide better.... ... ... The objective and the setting of the clinics defines the very important component of the microsystem.... These may include the clinicians and the supporting staffs, information, and technology and the specific healthcare processes that This paper seeks to analyze the cultural systems that exist in healthcare organizations ...

Preview sample

Determinants of plasma retinol and beta-carotene levels

3 pages (750 words) , Download 2 , Statistics Project

H0: coefficient of age=coefficient of sex= coefficient of smoking= coefficient of vitamin intake= 0, There is no significant relationship exists between Plasma beta-caretene and age, sex, smoking, and vitamin intake ... ... 0: Coefficients of age= coefficient of sex= coefficient of.... ... ... king= coefficient of calorie intake= coefficient of vitamin intake= 0, No significant relationship exists between plasma retinol and age, sex, smoking, calorie intake, and vitamin intake ...

Preview sample

Personal study skills

4 pages (1000 words) , Download 2 , Assignment

Through interacting with others I have been able to realize my strengths which I have taken advantage of in order to be able to achieve the set.... ... ... Through my interactions, I was able to learn how to cope with stress a factor that has helped me be able to meet deadlines and work efficiently towards my set goals....

Preview sample

Report

4 pages (1000 words) , Download 2 , Book Report/Review

Unlike the other kinds of wild inhabitants, the monkeys in question are very inclined and attracted to the social setting of human life.... In the documentation, one can.... ... ... The monkeys in question blend in with the ongoing activities just as well as the human beings in the setting. ... ... oncisely, the interactions between the human beings and the monkeys in Whilst the monkeys inhabit Jaipur's region of “Pink City,” they entertain people outside the temple....

Preview sample

Jewish History Response Paper

4 pages (1000 words) , Download 2 , Essay

This is because there are some attributes that these groups have that are very vital in that one cannot be sure whether they are from.... ... ... This captures best the reality of the Jewish and the individuals who posses Judaism who happen to live in the United States.... This will clearly indicate the differences or rather changes that the effects of Judaism and Jewish has This article effectively and efficiently handles these issues into various distinctive perspectives that are analytical and constructive in order to come up with a theoretical framework that can adequately assist in the fieldwork operations....

Preview sample

Locally Abundant' - Sustainable Food Documentary

4 pages (1000 words) , Download 2 , Essay

Sustainable food system should have the capabilities to produce, process, perform distribution and consumption in a community and environmentally friendly manner (Helms, 2004).... The type of food we buy, how they are grown and where they are produced can affect our personal health.... ... ... Most of the foods we buy from the stores are transported from miles way....

Preview sample

The Impact of Globalization on the Middle-Eastern Society . Evaluate

4 pages (1000 words) , Download 2 , Essay

This impact has especially been felt in the Middle East, whose society has ended up being affected in many different ways.... It should be noted.... ... ... that the ability of globalisation to have an impact on society tends to come about through many avenues such as politics, business, as well as cultural influence....

Preview sample

Boston Tea Party

4 pages (1000 words) , Download 2 , Research Paper

The party lasted for roughly three hours buts its echo was to imbue the history of the United States of America for the ages to come.... In the Boston Tea Party, almost 340 chests of tea.... ... ... by British East India Company, weighing roughly 46 tons onboard the ships Beaver, Eleanor and Dartmouth where hewn open with axes and dumped into the Boston Harbor (Volo 177)....

Preview sample

How could culture affect international business

4 pages (1000 words) , Download 3 , Essay

This means that there are different and varying factors that have to be considered when dealing with businesses in different areas.... ... ... ... Additionally, each individual business entity is affected differently according to its own area of specialization.... Therefore, as much as culture has a wide effect on usinesses across the business world, there are tiny variations in the way that each of these businesses are affected as per the exact mode of operation and specific cultural orientations of a given group of people (Becker 2013, p....

Preview sample

Music Culture - The Four Components

4 pages (1000 words) , Download 2 , Essay

Free

The writer of the essay "Music Culture - The Four Components" suggests that music culture explains the most important concepts of the music as such and emphasizes on them for a usual listener who normally does nothing but only listens to the music which is a pleasant activity needs some thinking....

Preview sample

Capital budgeting project

5 pages (1250 words) , Download 2 , Essay

In any business the decisions regarding the long-term investments are very crucial, therefore most businesses forecast their business portfolios and investments.... These calculations are based on estimated values used to analyze the strength of the portfolio or investment and.... ... ... The most commonly used financial process is Capital Budgeting, it is a process in which the investors decide that whether the investment is fruitful or not....

Preview sample

Blogs for innovation

4 pages (1000 words) , Download 2 , Essay

In 2006, a Dutch couple, Asha D'Souza and Louk Vreeswijk whose home country is Geneva moved to Madhya Pradesh in India.... Asha being a sociologist, she had an international experience in the.... ... ... On the other hand, Louk was an anthropologist as well as documentary film expert and had an interest in Indian culture, arts, and crafts....

Preview sample

A Curriculum by Definition

4 pages (1104 words) , Download 4 , Essay

Free

From the paper "A Curriculum by Definition" it is clear that a proper reading system challenges the student in learner to clarify their purpose in education and indulge the necessary skills to attain them.... Topics of paramount importance include communication skills and career planning.... ... ...

Preview sample

Essays on gate.io/signup/612995