quora
Nobody downloaded yet

Writing a protocol for genomic DNA extraction and PCR - Lab Report Example

Comments (0) Cite this document
Summary
10 μM stocks of Lambda primers, PC01: Forward-5’, GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5’-GGTTATCGAAATCAGCCACAGCGCC-3’’, template: bacteriophage lambda DNA (0.3 μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER95.9% of users find it useful
Writing a protocol for genomic DNA extraction and PCR
Read TextPreview

Extract of sample
"Writing a protocol for genomic DNA extraction and PCR"

Download file to see previous pages blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol . the sampling of the genomic DNA was used as templates for the PCR amplification with specific T .cruzi Mdna primers . Tcz1 and TC z2 and the KDNA primers s35 and s36 . the amplification reaction was run with 200ng templates DNA UNDER the subsequent conditions.0.2 Mm of each primer , 2.5 U Taq DNA Polymerase , 0.2 mM dNTP and 2 mM Mg Cl2 in a 25 ml final volume . the triplicate amplification reaction were performed using the recommendations temperatures for Ndna ( 950C for five minutes , 30 cycles of 950 C for 30 s , 620C for 1 min nd 72 0C for 1 min and final extension at 72 o C for 5 min ) . The amplicons were resolved in the 1.3 % agarose gel
The tumor tissue average RFU 0.254 corresponds to 406.25 standard and controls tissue average RFU 0.197corresponds to 275 standards. The curve is gently rises in a direct proportional manner to huge figures. The scale of the graph presents 1 cm representing 125 ng/ul in y-axis while the 1 cm representing the 0.1 in x-axis (Maria & Frank , 10).
22. It is important to remove the supernatant then dry the pellet at the prevailing room temperature. Normally, the DNA do not attach or stick as expected on the walls of the tube following 70% ethanol wash. Caution and extreme should be maintained while to bid avoid any aspirating the pellet
In conclusion, the protocol for DNA extraction and the PCR based typically on the main methods takes subsequent steps. In the process of extraction large quantities of the DNA may be necessitate heating briefly at 65oC) for the suspension. The resulting large great molecular weight may undergo several days for proper ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Writing a protocol for genomic DNA extraction and PCR Lab Report”, n.d.)
Retrieved from https://studentshare.org/biology/1685168-writing-a-protocol-for-genomic-dna-extraction-and-pcr
(Writing a Protocol for Genomic DNA Extraction and PCR Lab Report)
https://studentshare.org/biology/1685168-writing-a-protocol-for-genomic-dna-extraction-and-pcr.
“Writing a Protocol for Genomic DNA Extraction and PCR Lab Report”, n.d. https://studentshare.org/biology/1685168-writing-a-protocol-for-genomic-dna-extraction-and-pcr.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document
CHECK THESE SAMPLES - THEY ALSO FIT YOUR TOPIC
Agarose Gel Electrophoresis of DNA
(Westermeier 2006). Agarose gel electrophoresis is the most common and easiest technique to separate the DNA fragments. Agarose is a polymer that forms helical linking strands between the molecules and they are held together by hydrogen bonds. Based on the concentration of the agarose in the gel, the pore size also varies.
5 Pages(1250 words)Lab Report
DNA - The Double Helix
Adenine pairs with thymine while cytosine pairs with guanine. DNA was discovered back in 1868 by a Swiss physician, Friedrich Miescher who isolated “nuclein” a nuclei of cells which is today referred as
1 Pages(250 words)Lab Report
Extraction of plasmid DNA and set up of polymerase chain Reaction (PCR)
The genetic material being amplified can either come from isolation from the organism or a transformed microorganism to which the gene of interest was inserted for amplification and upkeep. By
5 Pages(1250 words)Coursework
DNA Restriction and Electrophoresis
Method: Three samples of DNA are extracted from bacteriophageand purified. These Purified samples of DNA number 48,502 base pairs in length. These samples are now segregated into four and are incubated at 37 combined individually with three different restriction endonucleases and the fourth sample, which is used, as a negative control does not have any endonuclease introduced into it.
4 Pages(1000 words)Lab Report
Protein synthesis/ DNA
he template strand of DNA, which contains a nucleotide sequence encoding for the protein identified in the answer to question 3c from the Transcription activity above: Glycine, methionine, valine, glutamic acid, glutamine, cycteine, cysteine, alanine, serine, valine, cysteine,
1 Pages(250 words)Lab Report
DNA Practical
The DNA from mitochondria and chloroplast is responsible for cytoplasmic inheritance or maternal inheritance. DNA is a double stranded nucleic acid and both the strands run antiparallel. It is made up of pentose sugar (de-oxy ribose), phosphate group and nitrogen base pairs (Double ringed Purines: Adenine and Guanine and Single ringed Pyrimidine: Cytosine and Thymine).
4 Pages(1000 words)Lab Report
PCR pratical Write-up Journal style.(VIROLOGY)
Human papilloma virus (HPV) 18-specific primers were used to amplify viral DNA. After 30 PCR cycles, the PCR products were subjected to agarose gel electrophoresis (AGE). Results showed that the genomic DNA of HeLa cells is contaminated with HPV-18 DNA
3 Pages(750 words)Lab Report
Detecting Cry1Ab gene in Mon0810 Transgenic Maize by PCR
After DNA is extracted from the maize, gel electrophoresis is done using agarose gel for the visibility of the DNA strands. A photograph of the amplified genes is then taken using a UV Trans illuminator. The photograph will provide a hard or soft copy of the DNA strands that
1 Pages(250 words)Lab Report
Identification of GMO foods using PCR Lab Report
The genetically modified reference standards were used as controls and the samples were analyzed using agarose gel electrophoresis. GMOs was not identified in all of our soy beans samples with PCR method, we rejected our null hypothesis that stated GMOs was present in our soy beans samples.
3 Pages(750 words)Lab Report
Protein Extraction and Gel Electrophoresis
Proteomic is generally defined as the direct analysis of proteins in terms of their presence and relative abundance. Gel electrophoresis is a significant methodology employed for extraction of proteins in proteome analysis. The most commonly used technique in gel electrophoresis is Sodium dodecyl sulfate-polyacrylamide gel electrophoresis.
5 Pages(1250 words)Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Let us find you another Lab Report on topic Writing a protocol for genomic DNA extraction and PCR for FREE!
logo footer
Contact us:
+16312120006
Contact Us Now
FREE Mobile Apps:
  • StudentShare App Store
  • StudentShare Google play
  • About StudentShare
  • Testimonials
  • FAQ
  • Blog
  • Free Essays
  • New Essays
  • Essays
  • Miscellaneous
  • The Newest Essay Topics
  • Index samples by all dates
Join us:
Contact Us