StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Nobody downloaded yet

DNA Extraction and PCR of Bird DNA for Sex Identification - Lab Report Example

Comments (0) Cite this document
Summary
The "DNA Extraction and PCR of Bird DNA for Sex Identification" paper aims to extract the DNA from the muscle, blood, and feather of Gallus gallus and to estimate the concentration of the DNA from the three samples and amplify the CHD1 gene using PCR…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER94.1% of users find it useful
DNA Extraction and PCR of Bird DNA for Sex Identification
Read TextPreview

Extract of sample "DNA Extraction and PCR of Bird DNA for Sex Identification"

Download file to see previous pages The difference in the phenotype is used as the basic identification step. Sometimes the phenotypic identification becomes complex in some species such as birds (they are monomorphic sexually). (Huffman and Wallace 2012). These birds are identified genotypicallyThe identification of DNA from the eggshell, feather, and blood is the safest way to determine the sex of the birds. (DNA sexing). The development of molecular markers to determine the sex of an individual is an extremely beneficial tool. In mammals, the males are heterogametic and they carry two different sex chromosomes X and Y and the females carry two identical sex chromosomes – X and X. whereas in birds, the males carry the homogametic sex (ZZ) chromosomes and the females carry the heterogametic sex chromosomes( Z and W). (Ellegren 2001). As many birds are not differentiated through phenotype, the use of molecular markers to identify the sex of the birds is practiced now. (Braun 2004). The chromo- helicase – DNA binding gene (CHD) is present in both the W and Z sex chromosomes but they vary in their size. Hence the use of size polymorphism in the CHD gene is the most common way of determining the sex of the birds. (Ellegren 2001).

The molecular markers were designed mainly concerning the primer binding regions of the CHD1 gene of the sex chromosome. The genes shared between the nonrecombining parts of the two types of sex chromosomes are the best means to study the genes in the sex chromosomes. The CHD1Z and CHD1W are found to share a highly conserved nucleotide and amino acid levels among them and they evolve independently. (Fridolfsson and Ellegren 2000).

The quality and quantity of DNA obtained from various samples such as blood, feather, eggshell, and skin may vary. Blood and organs are very rich sources of DNA and the quantity of DNA obtained from them will be high. (Frankham, Ballou and Briscoe 2004). Whereas the DNA from other sources such as feathers, eggshells will have less quantity of DNA and the quality of the DNA will vary because of the presence of the other impurities mainly proteins. (Silvy 2012). ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(DNA Extraction and PCR of Bird DNA for Sex Identification Lab Report, n.d.)
DNA Extraction and PCR of Bird DNA for Sex Identification Lab Report. https://studentshare.org/biology/1780653-genetic
(DNA Extraction and PCR of Bird DNA for Sex Identification Lab Report)
DNA Extraction and PCR of Bird DNA for Sex Identification Lab Report. https://studentshare.org/biology/1780653-genetic.
“DNA Extraction and PCR of Bird DNA for Sex Identification Lab Report”. https://studentshare.org/biology/1780653-genetic.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF DNA Extraction and PCR of Bird DNA for Sex Identification

DNA

Production of gametes through meiosis A basic tenet of embryology is the fusion of a male and a female gamete in the process called fertilization. The gametes are haploid cells that are produced in the testes and ovaries of the father and mother, respectively. They are produced in a cell division process called meiosis. This process is special because each of the resulting daughter cells contains just half of the chromosomes of the parent cell. In effect, a child receives 50% of each of the parent’s genetic material. Briefly, it involves two major processes, Meiosis I and then II, each composed of the usual processes of (1) prophase that prepares for (2) metaphase, in which the chromosomes meet in the middle, (3) anaphase, whereb...
4 Pages(1000 words)Essay

Identification and analysis of DNA repair mechanisms

...? Identification and analysis of DNA repair mechanisms that contribute to resistance against nucleoside analogues The human is exposed to a large number of agents each day that cause damage to the DNA within cell. Repair mechanisms play a crucial role in correcting the damage that has occurred, and allowing the cell to continue to replicate. In cancer cells, which have high levels of replication and inhibited cell death, DNA repair mechanisms can make treatment difficult, as the cells are able to correct changes that have been made by cancer treatments. Two methods of treatment where this is especially important are topoisomerase inhibitors and nucleoside analogues. In both of these cases, DNA repair systems involve the use of the Mre11...
20 Pages(5000 words)Thesis

Practical report on DNA Extraction Biological Science

...?Extraction of DNA from Kiwi fruit Extraction of DNA from a Kiwi (Actinidia deliciosa) fruit was attempted using simple household items. Thefruit was peeled, chopped and macerated with extraction buffer made from washing up liquid, salt and water. The mixture was incubated at 600C for 15 minutes using a home-made water bath and the mixture was then filtered with a coffee sieve. Finally, DNA was separated by adding ice-cold methylated spirit and was observed as white substances at the junction of alcohol and Kiwi fruit mixture. This proved to be a successful method to extract DNA from a Kiwi fruit in a quantity that permit visualization without a high-power microscope. INTRODUCTION DNA (deoxyribonucleic acid) is the basic structure of all...
4 Pages(1000 words)Assignment

DNA

...? The Unique Qualities of Blood, DNA, and Mitochondrial DNA Your The scene is so common its almost cliche: the courtroom drama climaxing with the identification of the killer by irrefutable DNA samples presented in court; yet what are these samples actually made of, and how do lab technicians utilize the unique qualities of human tissue to make specific identifications? The answer lies in deoxyribonucleic acid (DNA), and its unique composition. Like a fingerprint, each person has a unique DNA sequence that contributes to their individuality (NIH). DNA then goes on to encode for unique proteins that act as markers in the blood, which help lab technicians make specific identifications (NIH). Similarly, mitochondrial DNA can be used...
3 Pages(750 words)Essay

DNA

... DNA: The Basis of Life The question of “What is life, and what is it made of” has been asked to the point of making it cliche,if not ubiquitous, yet a multitude of answers persist. Life could be defined as a potential, as a response to external stimuli, or even as an indefinable feeling, yet none of these answers attempts to solve the question of what actually drives the biological engine of our bodies that keeps us breathing, pumping blood, and absorbing food. On April 25th, 1953, the now famous scientific pair of Watson and Crick attempted to finally answer this question (Fredholm). They claimed that an elegant molecule called deoxyribonucleic acid, or DNA, was the “God Molecule”, the blueprint for every protein in our body...
5 Pages(1250 words)Essay

Identification of Unknown Bodies using DNA

They are easily deformed due to injuries and scratches, and even suffer from the risk of being misinterpreted. Owing to technological advancements, fingerprint analysis has now been replaced by DNA (Deoxyribonucleic acid) analysis. Like fingerprints, the DNA of every individual is unique. This fact can be exploited for the determination of the identity of an individual by studying his/her DNA. DNA from hair, skin and nails, or even traces of semen or blood holds the key for the successful identification of a body, through the technique of DNA fingerprinting, also called DNA profiling or typing. DNA fingerprinting has been in use in forensic science since the time of its inception, and has helped in the identification of criminals...
7 Pages(1750 words)Research Paper

DNA

...DNA and protein Database assignment Part 1) Nucleotide numbers constituting the coding sequence of: E1 alpha: NM_000284.3  3390 E1 beta: NM_000925.3  1544 (2) Number of exons and introns present in the genomic sequence of: E1 alpha: NM_000284.3  Exons = 11 Introns = 10 E1 beta: NM_000925.3  Exons = 10 Introns = 9 (3) E1 Beta sequence – BLAST results (Description of three sequences with highest homology): Name Pyruvate dehydrogenase (lipoamide) beta (PDHB) Pyruvate dehydrogenase (lipoamide) beta (PDHB) Pyruvate dehydrogenase (lipoamide) beta (PDHB) Accession number NM_001131433.1 NM_001246418.1 NM_001195394.1 Organism Pongo abelii (Sumatran orangutan) Pan troglodytes (chimpanzee) Macaca mulatta (Rhesus monkey) Description mRNA...
3 Pages(750 words)Coursework

Extraction of plasmid DNA and set up of polymerase chain Reaction (PCR)

..., measurement or expression. The information obtained from this can further be used to characterize the resulting protein product or the organism from which it was obtained. Due to the vast amount of processes PCR products can undergo, the technique has been the staple for laboratory diagnosis of diseases, bacteria and virus identification, crime scene investigations, and others. As can be seen, PCR follows and precedes many other molecular processes. In this experiment, plasmids from a transformed bacterial cell pellet were extracted to isolate the gene encoding for red fluorescent protein (RFP). After measuring the amount of DNA extracted, it was then prepared for PCR. Methods The protocols for DNA extraction, quantification...
5 Pages(1250 words)Coursework

Lab 4 Infectious Bacterial Identification from DNA

Infectious Bacterial Identification from DNA Sequencing Infectious Bacterial Identification from DNA Sequencing Other ways of identifying bacteria such as Grahm staining and Ziehl-Neelsen staining which use staining of the bacteria using a special dye prove to be inefficient in comparison to genetic testing method that use DNA sequencing. Genetic testing has an advantage over the other methods due to its ability to identify the species that a bacterium belongs to rather than identifying only its genus. DNA sequencing involve identifying the DNA sequence of a bacterium then multiplying the DNA strands using the polymerase reaction that generate a lot of DNA strands for testing to note variations in different species (Witkowski 2005...
1 Pages(250 words)Lab Report

Writing a protocol for genomic DNA extraction and PCR

...By The of the The of the School The and where it is located The Protocol Title: to study the protocol for DNA extraction and PCR basing on the methods sections Materials, reagents and equipment The following reagents and materials were used in the process. 10 μM stocks of Lambda primers, PC01: Forward-5’, GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5’-GGTTATCGAAATCAGCCACAGCGCC-3’’, template: bacteriophage lambda DNA (0.3 μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP, dTTP, dGTP, dCTP), 50 mM Mg SO4, PCR grade water , PCR tubes, Nuclease free pipet tips with cotton, filters clean lab mat (Maria & Frank , 10). Procedure: Standard PCR reaction collected from the product manual...
4 Pages(1000 words)Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Lab Report on topic DNA Extraction and PCR of Bird DNA for Sex Identification for FREE!

Contact Us