Science Lab Reports Essay Samples and Topics Online

2 pages (571 words) , Download 0 , Lab Report

Free

A small flat mirror was attached to a small piece of wooden block, and the combination placed along the The paper 'Demonstration of Law of Reflection" is an excellent version of a lab report on physics.... PROCEDURE: The following equipment and materials were used during the experiment: Ruler, cardboard (8....

Preview sample

David Hatcher: Nikola Tesla On Free Energy And Wireless Transmission Of Power

6 pages (1500 words) , Download 3 , Book Report/Review

Free

According to his information the lab was burnt down after a meeting with J.... Nicolai Tesla had determined that science was the answer to creating a world without war, but in the end, it was the corruption of his era that was the most destructive force to him and to his work.... Nicolai Tesla had determined that science was the answer to creating a world without war, but in the end it was the corruption of his era that was the most destructive force to him and to his work. ...

Preview sample

Sports Performance Pathways

6 pages (1911 words) , Download 0 , Report

Free

This report "Sports Performance Pathways" presents a sport that is any game activity type that human beings take part in.... Most people go through performance pathways and they help them in ensuring that they perfect their skills in the specific type of game.... ... ... ... Judged competitions are a very common aspect of games....

Preview sample

Fe Oxide Experiment-Solid State Chemistry - X-Ray Diffraction and Characterization of Fe Oxides

8 pages (2441 words) , Download 1 , Lab Report

Free

One half of Fe3O4 made in experiment 2 was taken and transferred to 100ml beaker and the exact quantities used in the lab book remembered.... The paper "Fe Oxide Experiment-Solid State Chemistry - X-Ray Diffraction and Characterization of Fe Oxides" analyzes the experiments, the calculations, and the results, focusing on characterizing solid materials, grouping them according to their components and functionality....

Preview sample

Heat Pump and VCC Metering Devices Formal Report

3 pages (750 words) , Download 3 , Lab Report

Free

Heat Pump and VCC Metering Devices Summary: The primary objective of the study has been to learn the different components of heat pumps and understand the relationship between friction and the rates of water flow.... Experiments were conducted with the use of 3/8'' pipe, 1'' tee fitting and 1'' gate valve....

Preview sample

Macroeconomic Assessment of the European Union

13 pages (3747 words) , Download 0 , Report

Free

JRC Scientific and Technical reports, pp.... It has also been observed that the EU has a long term and strong relationship with the various modes of science and technology.... science, Technology and Environment.... This report "Macroeconomic Assessment of the European Union" analyzes the major drivers affecting the businesses within the EU....

Preview sample

Organizational Behavior

4 pages (1459 words) , Download 0 , Report

Free

P&G had a high-walled organization structure that isolated and insulated the technical development carried out at each subsidiary's lab (Bartlett & Ghoshal, 2003).... This paper ''Organizational Behavior'' tells that Proctor & Gamble was founded in 1837 by its founders – William Proctor – a candle maker from England, and James Gamble – a soap maker from Ireland....

Preview sample

Operation, Positive and Negative Aspects of Big Data

6 pages (1783 words) , Download 7 , Book Report/Review

Free

According to reports, it has been estimated that the number of need for deep-analytical expertise workers are approximately 190,000 (Kong, 2014).... Big data research and Development Initiative should be announced by the White House Office of science and Technology....

Preview sample

Infrared spectroscopy structural determination

1 pages (250 words) , Download 3 , Lab Report

Free

A lab instrument that is used to carry out this research is the Fourier transform infrared spectrometer.... A lab instrument that is used to carry out this research is the Fourier transform infrared spectrometer.... Infrared spectroscopy is the spectroscopy that ideally, handles the infrared zone of the electromagnetic spectrum, which usually comprises of light that has lengthy wavelengths and generally has very short frequencies....

Preview sample

Making Chocolate Pudding

1 pages (296 words) , Download 4 , Lab Report

Free

During the lab, I learned the process of developing chocolate budding via gelatinization process, which makes flour and all the starch granules to separate with cold either liquid or corresponding fats prior to their incorporation into the sauce.... In the paper 'Making Chocolate Pudding' the author provides the experiment, which demonstrates the correct way of making chocolate pudding and means through which starch gelatinizes in presence of heat and water....

Preview sample

The Synthesis of Sulfanilamide

4 pages (1000 words) , Download 4 , Lab Report

Sulfa drugs antimicrobials agents are synthetically manufactured with a wide spectrum encompassing most gram– positive and many gram– negative organisms (ORPHDT, Chrles, 2003).... These were the first efficient drugs to treat and prevent bacterial infections.... Generally, sulfa.... ... ... Most of these drugs are antibiotics and they act by inhibiting folic acid biosynthesis....

Preview sample

Prestressed Concrete Beam Test

4 pages (1250 words) , Download 8 , Lab Report

Free

ims of the lab Class.... Aims of the lab &description of the test procedure ... The paper "Prestressed Concrete Beam Test" describes the aim was to determine the pre-stressed concrete beams' shear strength.... The beam was loaded to about 80% of the ultimate flexibility capacity....

Preview sample

Determining Temperature Differences Using Thermocouple Tester and Thermo-imaging Camera

4 pages (1202 words) , Download 0 , Lab Report

Free

Submitted: Oct 27, Performed: Oct 20, lab Section: Diffusion and Premixed Flame Gregory E.... Gorbett lab TA: Matthew ... This paper ''Determining Temperature Differences Using Thermocouple Tester and Thermo-imaging Camera'' tells that This experiment aims to determine the heat temperature produced by the ordinary candle flame in which the oxygen combines with the fuel at the combustion zone and the laboratory Bunsen burner flame....

Preview sample

The Odyssey Book Report/Review

3 pages (750 words) , Download 2 , Book Report/Review

Homer's epic, The Odyssey, defines hero through Odysseus in many ways.... Odysseus is a wise, cunning, and successful man that has the additional luxury of the gods' favor.... He knows what it takes to win and he is not easily distracted for very long.... In his travels, he is determined and this quality allows him to endure....

Preview sample

Child Abuse Book Report/Review

7 pages (1750 words) , Download 2 , Book Report/Review

Child abuse and neglect have become a major issue throughout the U.... .... It affects every walk of life and is prevalent in every sector.... Three million abused children were in the emergency room in 2005, 1.... million of those were neglected, 800,000 were physically abused, 300,000 sexually abused, 100,000 emotionally abused and 1100 deaths per year (Hyden, 2009)....

Preview sample

Book Report About Capitalism/Entrepreneurship

4 pages (1000 words) , Download 2 , Book Report/Review

Atlas Shrugged, a novel written by Ayn Rand and published in 1957 in the US, is a criticism of the power exercised by the state as against the free will of the people.... As the title of the novel indicates, the story of Atlas has been used as a metaphor in this novel.... ... ... ... Atlas, “the giant who holds the world on his shoulders” has been equated with the citizens of a society, who are holding up the society as a functional entity....

Preview sample

Aspirin Production Process

9 pages (2567 words) , Download 2 , Report

Free

For example, in the lab, a carboxylic acid (C6H4 (OH) COOH) and an alcohol (CH3CO) 2 O) are normally heated in the presence of a catalyst (Jeffreys, 2005, p.... This report "Aspirin Production Process" proposes a fine chemical (aspirin) production process based on a comprehensive review of recently published literature....

Preview sample

Microwave Synthesis of Phenacetin

4 pages (1293 words) , Download 0 , Lab Report

Free

his lab demonstrates some important principles of green chemistry, which is being introduced in chemistry experiments to complement the existing conventional experiments that may be not friendly to human health and the environment.... The "Microwave Synthesis of Phenacetin " paper contains the experiment that was carried out with the aim of learning about an aspect of green chemistry; using microwave heating to synthesize the phenacetin instead of the conventional heating method....

Preview sample

Writing a protocol for genomic DNA extraction and PCR

4 pages (1000 words) , Download 3 , Lab Report

10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda DNA (0.... μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,.... ... ... The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol ....

Preview sample

Church in The Rise and Fall of an Uneasy Genius by Artigas

5 pages (1319 words) , Download 2 , Book Report/Review

Free

The authors are, William R Shea, who held the chair of History of science at the University of Padua at the time of writing this book, and Mariano Artigas, Professor of Philosophy of science at the University of Navarra.... The trial is to be seen in the light of that age when science was just in an emerging state and people were not ready to part with the age-old traditional concepts and embrace challenges of scientific hypotheses.... In his Letter to Castelli, he joined for the first time a debate over the relation that existed between theology and science....

Preview sample

Moving charge create a magnetic field

1 pages (250 words) , Download 2 , Lab Report

Free

rom the lab experiment carried out above, the objectives have been met and the Introduction When the electric charges are in motion, they normally create a magnetic field.... The magnetic field is normally measured in Tesla.... The magnetic field created in turn exerts a force on the moving electric charges which is given by: ...

Preview sample

Estimating the Damping in a Single Degree of Freedom System

5 pages (1250 words) , Download 2 , Lab Report

The systems in this lab represent examples of the simplest dynamical systems which might be encountered in engineering The movements include free response and forced response.... If only a single variable is used to describe the position then it is considered a degree of freedom....

Preview sample

Estimating the Damping in a Single Degree of Freedom System

5 pages (1250 words) , Download 2 , Lab Report

In this lab experiment, we are required to determine the damping ratio ζ, in a simple mechanical system that consists of a weight that is attached to a beam on one end.... A mechanical system can be said to be in vibratory motion if pats of its components are undergoing what is referred to as periodic oscillation about the central equilibrium position....

Preview sample

Flow Measurement and the Bernoullis Equation

5 pages (1227 words) , Download 0 , Lab Report

Free

This lab report "Flow Measurement and the Bernoulli's Equation" focuses on fluid that flows through various measuring devices and obstructions and the loss of pressure head.... FLUID MECHANICS lab: FLOW MEASUREMENT ...

Preview sample

What Are Some of the Differences between Normal Cells and Cancer Cells

4 pages (1045 words) , Download 0 , Lab Report

Free

Cell Reproduction lab Introduction Visual analysis of cells stained to observe mitosis, through either an optical or a fluorescent microscope, is a key procedure in cytopathology.... The paper "What Are some of the Differences between Normal Cells and Cancer Cells?... describes Visual analysis of cells stained to observe mitosis, through either an optical or a fluorescent microscope, which is a key procedure in cytopathology....

Preview sample

Lifelong Learning Book Report/Review

4 pages (1000 words) , Download 2 , Book Report/Review

Free

It is undeniable that lifelong learning has given way to raising aspirations.... The council-conducted research on participating men students is reported in the article that shows their masculine identities in contradictory, traditional, and aspiratory lights.... ... ... ... Learning has been considered as a leveller of inequalities, destroyer of economic barriers and recogniser of social relations....

Preview sample

Marketing Management Book Report/Review

16 pages (4000 words) , Download 2 , Book Report/Review

The first chapter is prologue to the entire book.... It explains the various concepts of marketing management to acquaint the readers with what they can expect in the books.... In the first chapter, he states that the purpose and definition of marketing has changed in the 21st century due to the impact of globalization....

Preview sample

Thomas Paine Book Report/Review

5 pages (1250 words) , Download 2 , Book Report/Review

America has suffered a lot in the hand of the British and there was a constant struggle for identity during that time.... People hold a very high regard for the founding fathers of America and when it comes to Thomas Paine, people still don't consider him efficient enough to be counted among the founding fathers of America....

Preview sample

Romantic Poems Book Report/Review

4 pages (1000 words) , Download 2 , Book Report/Review

Write an essay of 1000 words, in which you compare and contrast the treatment of the city in the following Romantic poem and extract from a Romantic poem: Mary Robinsons January 1795 and lines 624-41 from Book Seven of The Prelude by William Wordsworth ... ... t is one of the great ironies of the Romantic period that writers in particular, and society in general, were becoming more aware of the wonders of Nature at just the time that the Industrial Revolution was starting to produce cities on a scale and influence that had never been seen before....

Preview sample

American Politics Book Report/Review

5 pages (1250 words) , Download 2 , Book Report/Review

It is a common saying that sometimes what appears so obvious is not exactly the same as it is usually projected.... The same is the case with the political climate of America.... It is a common thought that the Americans are divided to the opposite extremes so far as the political issues of the nations are concerned....

Preview sample

Australian Literature Book Report/Review

5 pages (1250 words) , Download 2 , Book Report/Review

The Imitator", depicts Adamson's life in gaol and but he regrets doing so.... People paid it way too much attention, May people did not understand the context of the poem as it highlighted a lot of experiences which they had not been through. ... ... n aggressive counterbalance was provided through poems such as 'The Imitator', by its images of hypodermics, morphine, taking red lights at sixty-five, madness as well as prison homosexuality....

Preview sample

The Ramayana Book Report/Review

4 pages (1000 words) , Download 2 , Book Report/Review

In the original version of Ramayana written by Valmiki, Rama has been shown as a mortal.... However, in the later Tamil version written by Kamban, he is depicted as the seventh avatar of Lord Vishnu, the Hindu God of Creation.... (Rao). ... ... he Ramayana opines that Valmiki co-existed with Rama, and the complete saga of the Ramayana unfolded before his eyes....

Preview sample

Handling Disasters by Use of Remote Control

2 pages (500 words) , Download 2 , Book Report/Review

Free

It later on reports the information to the public to create awareness.... The younger aged can survive with psychosocial therapy and support from family and friends accompanied by hasty legal measures helps the patients in the healing process (Public Library of science, 2012).... 080/01431160701874553 Public Library of science....

Preview sample

Issues of a Welfare Law

6 pages (1907 words) , Download 2 , Report

Free

The paper "Issues of a Welfare Law" highlights that Street v.... Mountford is a groundbreaking judgment by the House of Lords.... This case set the precedent that the court would use in order to determine if a person's usage of the property was a tenant or a licensee.... ... ... ... 'In Street v....

Preview sample

Health Law and Ethics

6 pages (1761 words) , Download 1 , Report

Free

The paper "Health Law and Ethics" discusses health care fraud and abuse as one of the current health care situations and examine and evaluates how organizational structure and governance, culture, social responsibility affected or influenced health care fraud and abuse that happened in a hospital....

Preview sample

Acid base titration

5 pages (1250 words) , Download 7 , Lab Report

Free

Hypothesis Phenolphthalein change of color from pink/purple to colorless signified a transformation of the solution's nature from being basic to acidic, which was the reaction's endpoint or neutrality point.... .... ... ... Acid base titration Aim The experiment intended to ascertain concentrations of Dilute Hydrochloric acid and Dilute Sulphuric Acid solutions by conducting Acid-Base titrations....

Preview sample

Antibiotic sensitivity

4 pages (1000 words) , Download 2 , Lab Report

The third section contains the results generated from the lab report while the fourth section contains the discussions of the results generated herein.... This aspect is mainly used in epidemiological researches.... This paper illustrates a report on the test for sensitivity/ susceptibility of....

Preview sample

The Synthesis of Sulfanilamide

4 pages (1000 words) , Download 3 , Lab Report

These were the first efficient drugs to treat and prevent bacterial infections.... Generally, sulfa drugs contain sulfomide structure.... Most of these drugs are antibiotics and they act by inhibiting folic acid biosynthesis.... ... ... ... These were the first efficient drugs to treat and prevent bacterial infections....

Preview sample

Measurement of Reverberation Time and Calculation of Absorption Coefficients

4 pages (1235 words) , Download 3 , Lab Report

Free

or this lab experiment we have a microphone and the B&K type 2133 digital frequency analyser.... t is also worth mentioning here that during entire lab experiment all positions of the microphones, the equipment, furniture and other fittings were marked in order to have uniformity in results....

Preview sample

Classification of Common Objects

5 pages (1229 words) , Download 1 , Lab Report

Free

The paper "Classification of Common Objects" tells us about lab experiments.... UMUC Biology 102/103 lab 6: Taxonomy 15th October Experiment ification of common objects Questions Did you find that the items grouped together as you worked down the flow chart had similar characteristics in terms of their appearance?...

Preview sample

Hookes Law Laboratory

3 pages (923 words) , Download 8 , Lab Report

Free

The paper "Hooke's Law Laboratory" highlights that the potential sources of error in this experiment are due to the precision of the location measurement using the meter rule and the accuracy of the slotted masses used.... The meter rule was mounted vertically and behind the spring.... .... ... ... Hooke's Law is a basic physics principle that opines that the force required to extend or compress a spring by some distance is proportional to that distance....

Preview sample

Are the Clones Real People Never Let Me Go by Kazuo Ishiguro

4 pages (1000 words) , Download 2 , Book Report/Review

Free

any people associate cloning with science-fiction novels, not with real life, but animal cloning is a process that is being attempted today all over the world, and human cloning might be next.... Many people associate cloning with science-fiction novels, not with real life, but animal cloning is a process that is being attempted today all over the world, and human cloning might be next.... Many people associate cloning with science-fiction novels, not with real life, but animal cloning is a process that is being attempted today all overthe world, and human cloning might be next....

Preview sample

Age Differences in Verbal Memory

15 pages (4537 words) , Download 0 , Lab Report

Free

ata sheet for APP2013 lab Report ... eep this score sheet to include with your final lab report. ... PP2013 lab Report: Data Sheet... The paper "Age Differences in Verbal Memory" highlights that the average recalling rate of older adults in comparison to younger adults is lower....

Preview sample

Method of Determining the Cause of Fire

9 pages (2553 words) , Download 0 , Report

Free

nalysis and Critique of Fire Investigative reports Based On Incidences ... ifferent investigative reports have been commissioned to study and analyze different fire outbreaks.... These reports tend to develop a hypothetical argument of the cause of the fire outbreak.... This was meant to analyze the conflicting stance taken by the different reports.... The heights or depths of the chars obtained are then documented in a point to point form and estimated calculations done to act as future references (Gupta & Indian National science Academy 2003)....

Preview sample

Marxist Theory Book Report/Review

4 pages (1000 words) , Download 2 , Book Report/Review

Marxist literary criticism is stemmed from the political and economic theories of the German philosopher Karl Marx.... The body of ideas worked out by Marx (1818-1883) and Friedrich Engels (1820-1895) bore the name Marxism or Scientific Socialism.... The ensemble of all these ideas provided a fully functional theoretical basis for the struggles of the working class to achieve a higher form of human society....

Preview sample

Book Report for Hist 141

5 pages (1250 words) , Download 2 , Book Report/Review

Young Man Luther Young Man Luther was written by American developmental psychologist Erik H.... Erikson in 1958.... It is classified within the psychobiography genre, which seeks to understand historically significant individuals like Martin Luther, the author of the Protestant Reformation in the early sixteenth century, though the lens of psychological theory and research....

Preview sample

Organization Development Book Report/Review

19 pages (4750 words) , Download 4 , Book Report/Review

A book by Chris Argyris is entitled "Overcoming Organizational Defenses: Facilitating Organizational Learning.... It is a 169-paged book published in 1990 by Englewood Cliffs, NJ: Prentice Hall.... The book has four editions, and the other three editions were also published in 1990 by a different publisher....

Preview sample

American History Book Report/Review

5 pages (1250 words) , Download 2 , Book Report/Review

In this article, Fergus Bordewich addresses the confusing and lingering nature of lands owned by Native Americans.... The essence of the article is a question of legal status; more specifically, are these lands to be treated as belonging to sovereign nations (the Indian tribes), as constituting a territory more akin to a state, or some hybrid type of territory which possesses less independence than a sovereign nation but more independence than a state....

Preview sample

Radiographic Analysis Critique

11 pages (3173 words) , Download 0 , Report

Free

This report "Radiographic Analysis Critique" presents radiological reports that should be well structured to ensure that the person making reference to them can rely on the reports to effectively come up with a patient management plan.... The clinical referral, conclusion, and advice sections should be incorporated in radiological reports to help the clinicians in interpreting the information in the reports.... It is also necessary to ensure that only qualified personnel are allowed to participate in the production of radiological images and the making of radiological reports for the sake of the patient's health and well-being....

Preview sample

Understanding of the Youngs Modulus Concept

9 pages (2227 words) , Download 0 , Lab Report

Free

lab REPORT ... rrors resulting from lab measurements and recording of the data and information as well as the associated in accuracies ... This paper "Understanding of the Young's Modulus Concept" describes an experiment that is aimed at obtaining a comprehensive and clear understanding of the concepts, which include Young's modulus indifferently supported deflection beams, and gets you familiar with various problems and cases....

Preview sample

Essays on Science Lab Reports