Our website is a unique platform where students can share their papers in a matter of giving an example of the work to be done. If you find papers
matching your topic, you may use them only as an example of work. This is 100% legal. You may not submit downloaded papers as your own, that is cheating. Also you
should remember, that this work was alredy submitted once by a student who originally wrote it.
4 pages (1000 words)
, Download 2
, Book Report/Review
Free
Maalouf also writes about the Muslim culture which was constructive, as Muslim scholars were making significant contributions in the field of mathematics, philosophy and science.... A paper "The Crusades through Arab Eyes" outlines that scholars tend to focus on the wining force and ignore the perspective of the losing side....
Psychological reports, 52: 185-186.... The paper "Taste Preference of Soda in the lab" highlights that decision making is a very complex process in the brain.... When the consumer is asked to name one drink he/she prefers most from given two drinks with nearly similar properties brain draws information from many other aspects than taste....
The main focus of the paper "REPORT ON АSSISTАNСЕ TO FARM MАNАGЕRS " is on online and media marketing practices, the current state of play & project justification, envisaged project plan, project outcomes, Australian potato industry, farmers and the farm managers.... ... ... ... Marketing the potato products in the Australian potato industry would enable the potato farmers and the farm managers to make efficient decisions on how to improve their farming practices....
A lab instrument that is used to carry out this research is the Fourier transform infrared spectrometer.... A lab instrument that is used to carry out this research is the Fourier transform infrared spectrometer.... Infrared spectroscopy is the spectroscopy that ideally, handles the infrared zone of the electromagnetic spectrum, which usually comprises of light that has lengthy wavelengths and generally has very short frequencies....
During the lab, I learned the process of developing chocolate budding via gelatinization process, which makes flour and all the starch granules to separate with cold either liquid or corresponding fats prior to their incorporation into the sauce.... In the paper 'Making Chocolate Pudding' the author provides the experiment, which demonstrates the correct way of making chocolate pudding and means through which starch gelatinizes in presence of heat and water....
Sulfa drugs antimicrobials agents are synthetically manufactured with a wide spectrum encompassing most gram– positive and many gram– negative organisms (ORPHDT, Chrles, 2003).... These were the first efficient drugs to treat and prevent bacterial infections.... Generally, sulfa.... ... ... Most of these drugs are antibiotics and they act by inhibiting folic acid biosynthesis....
ims of the lab Class.... Aims of the lab &description of the test procedure
... The paper "Prestressed Concrete Beam Test" describes the aim was to determine the pre-stressed concrete beams' shear strength.... The beam was loaded to about 80% of the ultimate flexibility capacity....
Submitted: Oct 27, Performed: Oct 20, lab Section: Diffusion and Premixed Flame Gregory E.... Gorbett lab TA: Matthew
... This paper ''Determining Temperature Differences Using Thermocouple Tester and Thermo-imaging Camera'' tells that This experiment aims to determine the heat temperature produced by the ordinary candle flame in which the oxygen combines with the fuel at the combustion zone and the laboratory Bunsen burner flame....
3 pages (750 words)
, Download 2
, Book Report/Review
Homer's epic, The Odyssey, defines hero through Odysseus in many ways.... Odysseus is a wise, cunning, and successful man that has the additional luxury of the gods' favor.... He knows what it takes to win and he is not easily distracted for very long.... In his travels, he is determined and this quality allows him to endure....
7 pages (1750 words)
, Download 2
, Book Report/Review
Child abuse and neglect have become a major issue throughout the U.... .... It affects every walk of life and is prevalent in every sector.... Three million abused children were in the emergency room in 2005, 1.... million of those were neglected, 800,000 were physically abused, 300,000 sexually abused, 100,000 emotionally abused and 1100 deaths per year (Hyden, 2009)....
4 pages (1000 words)
, Download 2
, Book Report/Review
Atlas Shrugged, a novel written by Ayn Rand and published in 1957 in the US, is a criticism of the power exercised by the state as against the free will of the people.... As the title of the novel indicates, the story of Atlas has been used as a metaphor in this novel.... ... ... ... Atlas, “the giant who holds the world on his shoulders” has been equated with the citizens of a society, who are holding up the society as a functional entity....
For example, in the lab, a carboxylic acid (C6H4 (OH) COOH) and an alcohol (CH3CO) 2 O) are normally heated in the presence of a catalyst (Jeffreys, 2005, p.... This report "Aspirin Production Process" proposes a fine chemical (aspirin) production process based on a comprehensive review of recently published literature....
10 pages (2500 words)
, Download 2
, Book Report/Review
Free
The reporter describes leading and managing projects as a complex task as the manager or leader needs to analyze the project from a different perspective (Mumford, Zaccaro, Harding, Jacobs, & Fleishman, 2000).... ... ... ... The manager is not only responsible for completing the project within the required time and funds, but he has to make sure that the workforce is able to perform their task on time so that the overall project is delivered to the client within the specified duration (Witzel, 2003)....
his lab demonstrates some important principles of green chemistry, which is being introduced in chemistry experiments to complement the existing conventional experiments that may be not friendly to human health and the environment.... The "Microwave Synthesis of Phenacetin " paper contains the experiment that was carried out with the aim of learning about an aspect of green chemistry; using microwave heating to synthesize the phenacetin instead of the conventional heating method....
10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda DNA (0.... μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,.... ... ... The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol ....
rom the lab experiment carried out above, the objectives have been met and the Introduction When the electric charges are in motion, they normally create a magnetic field.... The magnetic field is normally measured in Tesla.... The magnetic field created in turn exerts a force on the moving electric charges which is given by:
...
The systems in this lab represent examples of the simplest dynamical systems which might be encountered in engineering The movements include free response and forced response.... If only a single variable is used to describe the position then it is considered a degree of freedom....
This lab report "Flow Measurement and the Bernoulli's Equation" focuses on fluid that flows through various measuring devices and obstructions and the loss of pressure head.... FLUID MECHANICS lab: FLOW MEASUREMENT
...
Cell Reproduction lab Introduction Visual analysis of cells stained to observe mitosis, through either an optical or a fluorescent microscope, is a key procedure in cytopathology.... The paper "What Are some of the Differences between Normal Cells and Cancer Cells?... describes Visual analysis of cells stained to observe mitosis, through either an optical or a fluorescent microscope, which is a key procedure in cytopathology....
4 pages (1000 words)
, Download 2
, Book Report/Review
Free
It is undeniable that lifelong learning has given way to raising aspirations.... The council-conducted research on participating men students is reported in the article that shows their masculine identities in contradictory, traditional, and aspiratory lights.... ... ... ... Learning has been considered as a leveller of inequalities, destroyer of economic barriers and recogniser of social relations....
16 pages (4000 words)
, Download 2
, Book Report/Review
The first chapter is prologue to the entire book.... It explains the various concepts of marketing management to acquaint the readers with what they can expect in the books.... In the first chapter, he states that the purpose and definition of marketing has changed in the 21st century due to the impact of globalization....
5 pages (1250 words)
, Download 2
, Book Report/Review
America has suffered a lot in the hand of the British and there was a constant struggle for identity during that time.... People hold a very high regard for the founding fathers of America and when it comes to Thomas Paine, people still don't consider him efficient enough to be counted among the founding fathers of America....
4 pages (1000 words)
, Download 2
, Book Report/Review
Write an essay of 1000 words, in which you compare and contrast the treatment of the city in the following Romantic poem and extract from a Romantic poem: Mary Robinsons January 1795 and lines 624-41 from Book Seven of The Prelude by William Wordsworth
... ... t is one of the great ironies of the Romantic period that writers in particular, and society in general, were becoming more aware of the wonders of Nature at just the time that the Industrial Revolution was starting to produce cities on a scale and influence that had never been seen before....
5 pages (1250 words)
, Download 2
, Book Report/Review
It is a common saying that sometimes what appears so obvious is not exactly the same as it is usually projected.... The same is the case with the political climate of America.... It is a common thought that the Americans are divided to the opposite extremes so far as the political issues of the nations are concerned....
5 pages (1250 words)
, Download 2
, Book Report/Review
The Imitator", depicts Adamson's life in gaol and but he regrets doing so.... People paid it way too much attention, May people did not understand the context of the poem as it highlighted a lot of experiences which they had not been through.
... ... n aggressive counterbalance was provided through poems such as 'The Imitator', by its images of hypodermics, morphine, taking red lights at sixty-five, madness as well as prison homosexuality....
4 pages (1000 words)
, Download 2
, Book Report/Review
In the original version of Ramayana written by Valmiki, Rama has been shown as a mortal.... However, in the later Tamil version written by Kamban, he is depicted as the seventh avatar of Lord Vishnu, the Hindu God of Creation.... (Rao).
... ... he Ramayana opines that Valmiki co-existed with Rama, and the complete saga of the Ramayana unfolded before his eyes....
5 pages (1547 words)
, Download 2
, Book Report/Review
Free
The author of the paper "Howard Gardner's The Disciplined Mind: What All Students Should Understand" will begin with the statement that Gardner's definition of intelligence refers to it as the biopsychological potential of a person, thus he has given importance to both mind and the brain.... .... ...
The paper "Health Law and Ethics" discusses health care fraud and abuse as one of the current health care situations and examine and evaluates how organizational structure and governance, culture, social responsibility affected or influenced health care fraud and abuse that happened in a hospital....
Hypothesis Phenolphthalein change of color from pink/purple to colorless signified a transformation of the solution's nature from being basic to acidic, which was the reaction's endpoint or neutrality point.... .... ... ... Acid base titration Aim The experiment intended to ascertain concentrations of Dilute Hydrochloric acid and Dilute Sulphuric Acid solutions by conducting Acid-Base titrations....
The Council of Mortgage Lenders reports that the rental market has increased by 14 percent between 2009 and 2010 (Capstick 2011) due to lack of lending availability with financial institutions that have changed their credit restrictions to remove risk from their lending models.... k/reports/a (accessed 8 March 2013).... [online] Available at: http://reports....
The third section contains the results generated from the lab report while the fourth section contains the discussions of the results generated herein.... This aspect is mainly used in epidemiological researches.... This paper illustrates a report on the test for sensitivity/ susceptibility of....
These were the first efficient drugs to treat and prevent bacterial infections.... Generally, sulfa drugs contain sulfomide structure.... Most of these drugs are antibiotics and they act by inhibiting folic acid biosynthesis.... ... ... ... These were the first efficient drugs to treat and prevent bacterial infections....
or this lab experiment we have a microphone and the B&K type 2133 digital frequency analyser.... t is also worth mentioning here that during entire lab experiment all positions of the microphones, the equipment, furniture and other fittings were marked in order to have uniformity in results....
The paper "Classification of Common Objects" tells us about lab experiments.... UMUC Biology 102/103 lab 6: Taxonomy 15th October Experiment ification of common objects Questions Did you find that the items grouped together as you worked down the flow chart had similar characteristics in terms of their appearance?...
The paper "Hooke's Law Laboratory" highlights that the potential sources of error in this experiment are due to the precision of the location measurement using the meter rule and the accuracy of the slotted masses used.... The meter rule was mounted vertically and behind the spring.... .... ... ... Hooke's Law is a basic physics principle that opines that the force required to extend or compress a spring by some distance is proportional to that distance....
ata sheet for APP2013 lab Report
... eep this score sheet to include with your final lab report.
... PP2013 lab Report: Data Sheet... The paper "Age Differences in Verbal Memory" highlights that the average recalling rate of older adults in comparison to younger adults is lower....
eneral Biology I lab Section U-27
... General Biology lab Manual / Second Edition.... This work called "Effects of Ampicillin on Transformation in Bacteria" focuses on the process of transformation.... From this work, it is clear that the transformation efficiency is greatly affected by the size of the plasmid....
4 pages (1000 words)
, Download 2
, Book Report/Review
Marxist literary criticism is stemmed from the political and economic theories of the German philosopher Karl Marx.... The body of ideas worked out by Marx (1818-1883) and Friedrich Engels (1820-1895) bore the name Marxism or Scientific Socialism.... The ensemble of all these ideas provided a fully functional theoretical basis for the struggles of the working class to achieve a higher form of human society....
10 pages (2500 words)
, Download 2
, Book Report/Review
Free
Markus suggest that it is better for any management to contribute to universal participation in a technological mode; this can be increased by providing the resources needed to access the medium or by lowering the skill and effort requirements to use it.... .... ... ... But in a globalising world where major antecedents indicate a diffusion of cultural differences, technology enables the cultural variation to stand alone in a single row....
12 pages (3000 words)
, Download 2
, Book Report/Review
What Fry & Jos have tried to focus on, is the excerpt of authors in this book from Max Weber to Dwight Waldo, Fry and Jos have covered eight contributions of administrators and have analyzed these authors in the light of various perspectives in the field of public administration.... ... ... ... From political science to practitioner, Fry & Jos have highlighted every aspect of their involvement in public administration but the best approaches they have identified through history of public administration is the classical and behavioral approach....
5 pages (1250 words)
, Download 2
, Book Report/Review
Young Man Luther Young Man Luther was written by American developmental psychologist Erik H.... Erikson in 1958.... It is classified within the psychobiography genre, which seeks to understand historically significant individuals like Martin Luther, the author of the Protestant Reformation in the early sixteenth century, though the lens of psychological theory and research....
19 pages (4750 words)
, Download 4
, Book Report/Review
A book by Chris Argyris is entitled "Overcoming Organizational Defenses: Facilitating Organizational Learning.... It is a 169-paged book published in 1990 by Englewood Cliffs, NJ: Prentice Hall.... The book has four editions, and the other three editions were also published in 1990 by a different publisher....
5 pages (1250 words)
, Download 2
, Book Report/Review
In this article, Fergus Bordewich addresses the confusing and lingering nature of lands owned by Native Americans.... The essence of the article is a question of legal status; more specifically, are these lands to be treated as belonging to sovereign nations (the Indian tribes), as constituting a territory more akin to a state, or some hybrid type of territory which possesses less independence than a sovereign nation but more independence than a state....
lab REPORT
... rrors resulting from lab measurements and recording of the data and information as well as the associated in accuracies
... This paper "Understanding of the Young's Modulus Concept" describes an experiment that is aimed at obtaining a comprehensive and clear understanding of the concepts, which include Young's modulus indifferently supported deflection beams, and gets you familiar with various problems and cases....
Electrical & Electronic Principles 2 Experiment Series Resonance Experiment Number: Section: Experiment: lab Partners:
... Besides, it has improved my data analysis skills and I would recommend that more of such lab experiments be carried out to improve students understanding of the theory....
In Annetts v Australian Stations Pty Ltd (2003), the story as per the plaintiff and reports went thus; in 1986, James Annetts, a 16 year old boy, went to work as a farm hand at a cattle station in Western Australia, an area known for its remoteness and extremely harsh weather conditions....
The paper "ASIC Financial Investment" is a great example of a report on finance and accounting.... The report looks at ASIC financial investment; it focuses on the daily short sales and the most sorted stocks.... It 'considers stock pricing and the adjustments made for dividends and splits.... Finally, the report gives findings in terms of weights at the end of the analysis....
This report "Madison Resort and Spa: Marketing Plan Resort" is about various issues that have been discussed in this report including company profiling, services offered by the hotel, evaluation of the company using the SWOT analysis to determine the strengths, weaknesses, opportunities.... ... ... ...
This paper ''The Hotel and Resort Management'' tells that The following paper aims at developing a proposition for property development in Inverness City, UK for the Sofitel Hotel chain.... Sofitel Hotels are luxury French hotels managed by Accor with about one hundred hotels scattered in forty countries....
10 pages (2890 words)
, Download 2
, Book Report/Review
Free
This paper "The Postmodern Condition: A Report on Knowledge by Lyotard" presents the book which is prominent among current socialist thinkers that it is often considered to be a handbook for further researches on the pluralistic aspects of postmodernity.... ... ... ... The book does not for a single moment fails to grapple the readers' consciousness about the integral shortcomings of a universalist overview of knowledge....