Our website is a unique platform where students can share their papers in a matter of giving an example of the work to be done. If you find papers
matching your topic, you may use them only as an example of work. This is 100% legal. You may not submit downloaded papers as your own, that is cheating. Also you
should remember, that this work was alredy submitted once by a student who originally wrote it.
The Problem of Conformity Name of Author Author's Affiliation Author Note Author note with more information about affiliation, research grants, conflict of interest and how to contact The Problem of Conformity Introduction: The essay aims at demonstrating that ‘conformity' is deep rooted in American minds and therefore non Conformity is widely defected issue in the country....
The Effect of Bullying on Children Instructor University The Effect of Bullying on Children Introduction: Bullying can be defined as the use of superior strength or force to influence someone to do something they do not want to do.... ... ... ... Verbal acts such as threats or insults can also be considered as bullying....
Name Date Professor's Course Section/# Economics and Environment: An Analysis of “Nature as historical protagonist: environment and society in pre-industrial England” The first article that will be examined for purposes of this analysis and review is entitled “Nature as historical protagonist: environment and society in pre-industrial England”....
4 pages (1000 words)
, Download 7
, Research Paper
Critique of “Therapeutic hypothermia after cardiac arrest in clinical practice: Review and compilation of recent experiences” Abstract This report will offer a critical analysis of the specific research article.... It will cover everything from the credentials of the researcher all the way to an in depth analysis of the article itself....
INTRODUCTION There have been a lot of assays for paracetamol being done in the laboratory and one of the methods being used is colourimetry.... Colourimetry is a method of analysis that deals with the determination of trace level analytes.... It is a quantitative analysis in which the quantity of a colored constituent is determined by measuring the relative amount of absorption of light passing through a solution of the constituent (G....
Trends and behavior Name: Institution: The internet has become a core component of day to human activities.... Most people use the internet for commerce, communication and sharing of information.... Most academic institutions have also embraced internet as a tool of managing academic programs and student interaction....
Name: Tutor: Course: Date: “I Am Legend” By Richard Matheson Part 1: Summary One man still stands in a world plagued by vampire-like creatures which were formerly animals and human beings.... Robert Neville who resides in Los Angeles, was the last man standing after a pandemic swept through the earth causing victims to depict vampire-like symptoms....
Date INTRODUCTION Time series is a set of statistics that is collected regularly; it happens naturally and in diverse applications like in economics, finance or even medicine fields.... Time series analysis predates the general stochastic procedures with their aims of describing and providing summaries of time series data; fit the low-dimensional models like the series of ARIMA and making forecasts in relevant environs (Franses, 1998)....
5 pages (1000 words)
, Download 3
, Research Paper
Free
The paper "Introduction to the Hypothesis Testing" concerns the importance of the hypothesis testing.... Therefore, the writer describes multiple aspects, such as level of significance, decision and test statistic.... Finally, the research looks at the null and alternative hypothesis.... ... ... ...
Your F.... 2 December 2011 Patrolling Policeman Ride Along On a ride along with Officer B.... Kerr, with the Lawson Police Department in Lawson, Missouri, badge number 5.... Officer Kerr allowed me to do a ride-along with him on his shift on December 2-3, 2011 on the overnight shift during the time of 9 p....
4 pages (1000 words)
, Download 3
, Research Paper
Name Instructor Task Date American and Great Civil War Introduction The major cause of American civil war was from a fundamental discrepancy between two sectors, North and South, concerning the position of slavery in the Union.... Exclusive of the slavery subject, there would be no battle.... ... ...
4 pages (1000 words)
, Download 2
, Research Paper
The DNA mechanisms of hyperthermophilic archaebacteria have been gaining interest because they must be able to work against the chromosomal damage that happens more often due to the extreme environment the organisms thrive at.... In the research conducted by Rolfsmeier, Laughery and Haseltine (2010), the repair mechanisms of UV-C-induced double strand breaks in three strains of Sulfolobus solfataricus, a popular model system for hyperthermophilic bacteria, were characterized....
Name History and Political Science 16 October 2012 How French Colonialism Affected the Class Structure of Vietnam The life of Vietnamese society before the French colonization in 1874 was centered on the village.... The social structure was primarily patterned after the Chinese system where a vast majority of the population were farmers....
4 pages (1000 words)
, Download 2
, Research Paper
Free
The paper "Core Issues that Society Faces" states that society faces situations that are bitter and discouraging, films created as a result help shape the future of society.... The society is left to make its own decisions after the vices have been highlighted and expressed to reveal the situation....
I study in the same college with my sister but our streams are different.... I am in the II year Arts and she is in the III year Science.... We reach college together.... The security staff often greets us with a smile, “Ideal brother and sister!... ?? Our disciplined.... ... ... “Go and come together, you children need to know how save money on gas,” Dad often says and Mom is happy with this arrangement.
...
5 pages (1250 words)
, Download 2
, Book Report/Review
Free
The paper "Summary of The Things They Carried by Tim O'Brien" states that O'Brien wants to make his readers think about the real truth and the information provided by the authorities.... He emphasizes that official information about the event usually misses many important moments.... .... ... ... When we read Tim O'Brien's stories for the first time, we become so deeply involved with the characters and the plot, that we can hardly believe the fact that these stories are fictional....
Offender profiling is a method of identifying the perpetrator of a crime based on an analysis of the nature of offense and the manner in which it is committed (Teten 1995).... Various aspects of the criminal's personality makeup are determined from his choice of actions before,.... ... ... This information is combined with the physical evidence and other pertinent details and then compared with the characteristics of know personality types and mental abnormalities, to develop a practical working description of the offender....
The analysis of audience involves identification of the audience as well as adaptation of the speech to the audience's interest, Attitudes, beliefs, and level of understanding as.... ... ... Taking an approach that is audience – centered happens to be important since the effectiveness of the speaker is improved where the presentation is created as well as delivered in a manner that is quite appropriate....
They are vitally found in many parts of the body such as the hair, skin, muscles, tendons, cartilage, and many more.... They are also found in the enzymes, globulins, hormones, hemoglobin, myoglobin and other substances in.... ... ... 2013).... Proteins are the basis of living tissues.... They are made up of amino acids coded by the genes....
The retails also offers premium branded pet foods, cats and dogs high quality accessories.... The stores also offer accessories for.... ... ... Over the last four years, Bosley by Pet Valu has expanded to over 47 locations with different stores in British Columbia.... Some of its convenient locations are currently found in Vancouver Island, Squamish, The Company is driven by a commitment towards its client that basically involves a guaranteed satisfaction among its clients; with an agreement to refund clients in case they fell they are not properly served (www....
10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda DNA (0.... μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,.... ... ... The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol ....
The author of this coursework "Personal's IELTS Scores" seeks to investigate the relationship between a person's IELTS scores in listening and reading when doing the math.... Reportedly, the data was collected by randomly selecting the test scores from three different classes.... .... ... ... The test was divided into two sections that include descriptive and inferential statistics....
4 pages (1179 words)
, Download 3
, Research Paper
Free
The paper "Assessment of Genetic Mechanisms of Bipolar Disease and BDNF" tells that bipolar disease is one of the chronic mood disorders.... The lifetime incidence of this condition is estimated to be at least 1 per cent.... Epidemiological studies have incriminated both environmental.... ... ... ...
The paper "State of Connecticut versus Jeffrey Jackson" highlights that criminology involves court trials and charges that heavily rely on constitutional requirements as well as individual perspectives by which courts and law firms use to come up with overall contextual charges.... ... ... ... This dissertation will look into the case of the state of Connecticut versus Jeff Jackson, which will outline activities that took place after the appeal in the Appellate Court....
This assignment "UK Workers in Year 2004" focuses on the sample size as represented by N is 21600 while the value of R2 is equal to 0.... 25.... The numbers in parenthesis are the standard errors of each estimated coefficient.... The coefficient for the variable Age is 0.... 43.... ... ... ... The numbers in parenthesis are the standard errors of each estimated coefficient....
The paper "Vitamin C and Content of Soft Fruit Drinks" gives detailed information about vitamin C that is a common component of various fruits and vegetables, especially citrus fruits such as oranges and lemons.... Admittedly, his important vitamin serves various different functions in the human body....
From the paper "Relationship between Drugs and Grade Point Average" it is clear that drugs have critical impacts on individual GPA.... This is especially the case in higher learning institutions and high schools where there are a huge number of students who are engaged in drug abuse.... ... ... ... The relationship between drugs and Grade Point Average (GPA) raises controversial debate among professionals from different social and cultural backgrounds....
This report "Use of Gravimetric Analysis in Determining Mass Percent of Unknown Chloride" discusses gravimetric analysis of quantitative parameters in physical chemistry.... The precipitation technique is important in the quantitative analysis of individual elements within insoluble salts.... ... ...
The paper "The Journey of Man: A Genetic Odyssey" states that generally speaking, the fact that the male chromosome has a huge part in Wells's research, and the reason why people from different groups have different physical features caught my interest.... ... ... ... 'The Journey of Man: A Genetic Odyssey' is a National Geographic documentary made on the book with the same title, and hosted by the author of that book, Spencer Wells....
The paper "Mutation That May Lead to Breast Cancer" states that BRCA-1 is a gene normally found on the 17th chromosome, a healthy BRCA-1 will always suppress tumor growth.... Improper functioning or loss of the function of this gene will result in cancer or increase the chances of getting cancer....
4 pages (1000 words)
, Download 0
, Book Report/Review
Free
People tend to believe in the information provided in official resources.... The paper "Issue Of The Official Information Authenticity " discusses Tim O'Brien's book "The Things They Carried" and how the author makes readers think about the real truth and the information provided by the authorities....
The paper "Data Collection Procedures" discusses that Data will be collected from online databases using different search engines and key terms: drug abuse, and domestic violence.... Obtained data will then be reviewed to determine their relevance to the study.... ... ... ... The study will use phenomenology, a methodology that explores people's experiences to develop meanings from the consequences of phenomena....
The paper seeks to discuss the budget cycle of the City of Portland, Oregon.... Basically, a budget cycle consists of four key stages which involve the following: Budget preparation, approval, execution, audit and evaluation (Chapter 3, n.... .... .... all these tasks in the cycle of the.... ... ...
4 pages (1101 words)
, Download 0
, Research Proposal
Free
The purpose of this paper 'Legalization of Euthanasia' is to determine the opinions of people from different age groups on euthanasia.... For this research focus group methodology, which is a qualitative method would be applied.... The Focus group method used here has a number of advantages.... ... ...
20 pages (5674 words)
, Download 1
, Research Paper
Free
Some of the best examples, in fact, lie immediately to the right just as one enters.... This work called "Critic of Pollock's Art" describes the artist's paintings, his style of art.... The author outlines the role of Lee Krasner in enhancing Pollock's life as an artist.... From this work, it is clear about all peculiarities of his biography, creative development, the modern critic of his paintings....
This essay "An Encumbering Emotional Dilemma in Adulthood" focuses on an intricate performance defined, stationary condition of the undeveloped brain, which is emerging as a subject of great concern due to augmentation in a number of cases with time.... .... ... ... Autism is a subtle yet very devastating neurobiological abnormality that can be either high-functioning or low-functioning....
Colorectal cancer comprises 98% of all malignant tumors of the large intestine.... It is the commonest form of visceral cancer, next to lung cancer in the United States (Mohan 601).... Approximately 35, 000 people develop colorectal carcinoma in the UK every year, making it the third most common cancer in the UK (Verrill, 1165)....
This report talks about The Seven Daughters of Eve by Bryan Sykes.... The discussion stresses that the author provides an easy-to-read account of his own activities in the field of mitochondrial DNA research and the findings those studies yielded.... .... ... ... According to the paper Sykes presents this tale with the rambling, conversational style of a chum at the bar while presenting key concepts of the science and the evidence to back his claims....
These are the results garnered from an experiment carried out to investigate and study the effects of short-term stress among test takers.... This was done in order to establish the fact that stress levels of any kind have significant effects, which may be positive or negative on the cognitive abilities of people....
The entire article deals with the effect of being attractive on the organizational decision making process.... It exhibits a plenty of favoritism directed towards extremely attractive people.... ... ... ... The entire article deals with the effect of being attractive on the organizational decision making process....
4 pages (1000 words)
, Download 3
, Research Paper
Atrial Fibrillation Date Abstract The essay aims to address the following objectives to wit: (1) to identify the statistical procedures used in the study; (2) to describe the strengths and weaknesses of the study; (3) to explain the statistical significance of the findings of the study; and (4) to determine the appropriateness of the conclusion....
This paper describes the Bacillus anthracis.... The bacteria may enter the human body by inhalation, through fissures in cutaneous membranes, or through the gastrointestinal tract following ingestion.... Attention has been given to the potential of anthrax as an agent for bioterrorism.... ... ... ...
Marketing Promotional Mix 1.... Marketing Communication Objectives 1.... Create a brand awareness for your company The purpose is to generate and stimulate attention and awareness, that is, to let the target market know about your products features, attributes and benefit.... ... ... ... The objective is also to let them know where they can find the product....
In the paper 'The Frequency of Changes' the author describes how the frequencies of the alleles which control a trait change over time.... Populations allow a study of the frequency of changes, and gene frequencies enlighten science as to the processes of evolution.... ... ... ... The author states that a key issue for the dynamic evolutionary change of any organism is the measurement of variability....
Insert name Name of institution Name of professor Date Introduction Nursing is one of the noblest professions which require a lot of patience to execute the noble duties that one has been called upon to carry out.... Like any other profession that deals with the saving of human life, nursing requires that the practitioner gives utter devotion to his or her work since human life is considered very important above all things and should be dealt with in a very careful manner....
Uncertainty Avoidance and Country Risk Ratings....
... The purpose of this dissertation is to explore the relationship between country risk ratings, the economic measures associated with the likelihood of sovereign debt default and Hofstede's Uncertainty Avoidance score.... ... ... ... Recent research on the changing nature of country risk due to globalization and the inherent rise in the interconnectivity of national economies (Cleary & Malleret, 2007; Baytas & Leveen, 2009; Sheppard, 2002; GAO, 2010) has called attention to the requirement for reliable country risk ratings to guide investment as these ratings are utilized by financial analysts as a tool to indicate the likelihood of payment defaults by sovereign borrowers (Hoti, McAleer & Shareef, 2007)....
The professional discipline of anthropology is a relatively new science, born out of the combination between the natural and social sciences, resulting in the “science of humanity” that compares different societies and cultures, but almost always with Western culture as a superior point of reference....
The Little Red Hen Story is of Old English folklore origin used worldwide widely in the process for imparting Pre-school Language Arts Lesson.... In the story the Little Red Hen discovers a grain of wheat,.... ... ... asks all the other animals surrounding her – which constitutes a cat, a mouse, a dog, a goose, a duck, a cow and/or a horse – to help her productively grow the wheat from its planting, harvesting, threshing, milling and finally baking the flour into bread....
This study aims to find the relevance of field survey in topographical representation to the feature representation in digital data base within the physical landscape.... As the individual mapping databases became more centralized at national scales, the feature lists applied to.... ... ... Further, field objectives include survey and off side field works to undertake sample excavations and finalize the processing of excavated data which is crucial for interpretation of the mapping results....
4 pages (1000 words)
, Download 3
, Research Paper
Free
Social hierarchy at schools is very special; there are always popular students who are loved by everybody.... This essay will focus on bullying and cyberbullying among high school students outlining main features and outcomes of this social phenomenon.... .... ... ... According to the report this hierarchy and power inequality leads to repetitive aggression towards the weak which is defined as bullying....