StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Advise Barry, Edna and Gwen of their rights - Essay Example

Cite this document
Summary
As he handed over the watch, Les told Barry that he was to have the watch. However, when Les left later that day, he took the watch with…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER92.6% of users find it useful
Advise Barry, Edna and Gwen of their rights
Read Text Preview

Extract of sample "Advise Barry, Edna and Gwen of their rights"

Download file to see previous pages

The following day Les took the title deeds to a cottage he owned in Southport and wrote on them ‘All this now belongs to Edna’. In July 2009, Les was diagnosed with cancer. He said to his mistress, Gwen: ‘It is my dying wish, Gwen, that you should have my Knightsbridge penthouse apartment. Here are the keys to the apartment and to the deed box which is at my bank. Put them in your bag. My solicitor will sort out the details when I am dead.’ Advise Barry, Edna and Gwen who wish to know whether they are entitled as beneficiaries under completely constituted trusts of, respectively, (i) the watch, (ii) the shares and the cottage, and (iii) the Knightsbridge apartment.

In order to advise the parties in the above, it is necessary to determine whether any of the bequests would be regarded as valid. When determining the validity it is necessary to ensure that the dispositions have been fully constituted. Within the law of trusts and bequests certain formalities have to be adhered to in order for the trust document and will to be regarded as valid. As there is no indication in relation to the age and mental status of Lee it will be assumed, in this instance, that the requirements of the Family Law Reform Act 1969 s1(1) have been satisfied.

Where a trust is created in a will, the courts will determine the validity by reference to the Wills Act 1837 s9 which was amended by Administration of Justice Act 1982 s. 17. With all bequests, the three certainties need to be present in order for the bequest to be fully constituted. The three certainties are certainty of intention1, certainty of subject matter2 and certainty of objects3. Intention can be inferred from the wording in the will, and it is therefore important to ensure clarity when making a will.

The case or Re Kayford demonstrates that the word trust does not need to be included in the wording of the will in order for the

...Download file to see next pages Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Advise Barry, Edna and Gwen of their rights Essay”, n.d.)
Advise Barry, Edna and Gwen of their rights Essay. Retrieved from https://studentshare.org/miscellaneous/1561879-advise-barry-edna-and-gwen-of-their-rights
(Advise Barry, Edna and Gwen of Their Rights Essay)
Advise Barry, Edna and Gwen of Their Rights Essay. https://studentshare.org/miscellaneous/1561879-advise-barry-edna-and-gwen-of-their-rights.
“Advise Barry, Edna and Gwen of Their Rights Essay”, n.d. https://studentshare.org/miscellaneous/1561879-advise-barry-edna-and-gwen-of-their-rights.
  • Cited: 0 times

CHECK THESE SAMPLES OF Advise Barry, Edna and Gwen of their rights

Barry Humphries and Patrick White

His best known roles are Dame edna Everage, a Melbourne housewife, and Sir Les Patterson, a foul-mouthed Australian cultural representative to Britain.... It was now that he created the first version of his most famous character edna Everage.... The old fashioned housewife originally created as a character of Australian suburban narrow-mindedness, evolved over forty years to become a flamboyantly dressed, internationally acclaimed star, Dame edna Everage....
9 Pages (2250 words) Essay

How Does Communication Differ in Helping Relationships

The researcher of this essay will make an earnest attempt to study how definitely such lifestyle changes have caused young men and women to change their behavior and communication with the real people they have to deal with on a daily basis.... hellip; The idea of this research emerged from the author's interest and fascination in how does communication differ in helping relationships....
14 Pages (3500 words) Essay

Writing a protocol for genomic DNA extraction and PCR

10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda DNA (0.... μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,… The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol ....
4 Pages (1000 words) Lab Report

Financial Management And Analysis

It also provides the company with various revenue streams to facilitate its expansion and growth.... My Finance Resource Limited is registered company in… The company aims to acquire larger local market share and also penetrate the international market.... Operating in a competitive industry, the company intends to spend large amount of money on The company intends to offer competitive prices besides other programs such as buyback/trade program that makes it easier for the members to access and read Finance books online....
16 Pages (4000 words) Assignment

The Image of Women in Advertising

During that era, many women activists advocated for their rights to vote.... Therefore, the advertisement supported the push for women to have equal rights.... In 1923, Listerine launched an advertisement that featured a model named edna.... Over the years, advertisers have sexualized women and portrayed them as sexual objects....
8 Pages (2000 words) Essay

Barry Humphries and Patrick White

His best-known roles are Dame edna Everage.... In the paper “barry Humphries and Patrick White” the author discusses two notable individuals who contributed to Australian theatre – Patrick Victor Martindale White and barry Humphries.... John barry Humphries is a satirist, a character actor and a comedian.... barry Humphries was born on 17 February 1934 in Melbourne, Australia.... Other than acting barry Humphries also wrote comic strips....
10 Pages (2500 words) Essay

The Theory of Functional Grammar

The focus of this paper is to apply functional grammar theory and critically evaluate the lexico-grammatical meaning of the sample three texts, all of which involve instructional and educational interactions between adults and children in differing contexts … On this basis, it is submitted that the interrelationship between the lexico-grammar hierarchy ranking words, in turn, changes the reader's perceptions about the three texts to slow down our process in reading the texts....
17 Pages (4250 words) Essay

Public Law - Access to the Countryside Association

This paper "Public Law - Access to the Countryside Association" focuses on the way that reduces the possibility of court action against people through marking rights their contribution and access points.... The trespass on protected land access land as created by Countryside law and rights may advise possible users on their entitlement to returning to the land within 72 hours.... It is important to advise on the need for helping them explain the environmental issues....
9 Pages (2250 words) Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us