Analyzing for the Expression Level of RhoB Protein in Breast Cancer Cell Lines - Essay Example

Table of Contents Table of Contents This project investigated the level of expression of the RhoB protein in the cell lines that include MCF10a, MDA-MB231 and MCF7.Amongst these cell lines, MCF10a is non-motile non-transformed mammary epithelial cells but MCF7 is weakly invasive mammary cancer cells and Mda-mb231 is highly invasive mammary cancer cells. In the investigation of this expression level, the cell lines were taken through cell culture with RNA isolation, cDNA library and PCR agarose gel, taking pictures of three different types of cells. From the cell culture, the next study was about cell morphology within the progress of the project. This was done with emphasis on RHoB protein. RhoB protein is not important in the development but it impacts the growth and adhesion factors of the transformed cells. The RNA was isolated from the 3 cell. The cDNA library was then constructed using the isolated RNA as the template strand. This step was after isolation and purification. The samples were later amplified using PCR and analyzed by gel electrophoresis and imaging. GAPDH primers were used in each cell lines in order to compare the results obtained. Positive control of GAPDH was also used to eliminate any extraneous variables. It is well known that RNA/mRNA is directly proportional to the proteins being expressed in the cell. In this case we measured the level of RNA to help us determine the level of expression of the protein of interest which is RhoB protein in the three cell lines that include MCF10 A, MCF7 and MDA – MB 231. According to the results, it is clearly evident that the three cell lines had different levels of the RhoB proteins that were expressed Keywords:, RHoB, cDNA,PCR 1.0. Introduction RhoB can be defined as a quick early reaction gene quickly inducible by numerous jolts including genotoxic anxiety, cytokines and development variables (Gerald, 2013). In contrast, despite RhoB being related to vast family comprising of GTPases (RhoA/Rac1/Cdc42), RhoB is uniquely located in the cytoplasm (Huang et al., 2007). In relation to this, it is most precisely found on the endosome. RhoB is linked with regulation of vesicles and also in trafficking of growth factor receptors (Gerald, 2013). The function of the RhoB protein is to mediate apoptosis in cells that have been transformed neo-plastically after DNA damage (Fritz and Kaina 1997). RhoB protein is not important in the development but it impacts the growth and adhesion factors of the transformed cells. It usually plays a negative role in tumor genesis because when it is deleted, it contributes to the formation of tumors cells. This means that cancer cells (breast cancer cells) have low levels of these RhoB proteins. Practically, in an experiment to evaluate the impact of RhoB deletion in a tissue, a mouse ear was used. The ear was subjected into full thickness wound to determine the angiogenesis and Lymphangiogenesis in RhoB wounds (Gerald, 2013). After one week, it was evident that the RhoB wounds exhibited very poor neovascularization (Gerald, 2013). There were two fold formed and which contributed to lower vascular density. Additionally, the CD31 immunostaining revealed both the presence of positively stained blood vessels and additional structures bearing different morphology (Gerald et al, 2013). These structures were uniquely exhibiting weak staining intensity. In agreement with other studies, it was evident that RhoB protein was responsible in generating profound lymphangiogenetic response (Gerald, 2013). In such scenario, the response was judged by rapid filling of a distinct lymphatic network (Gerald, 2013). This was noted from 2-10 seconds after the tracer injection which later kept on progressively increasing by 30s. As time progress, between 30- 60s FITC-dextran which was accumulated in the tissues immediately surrounded the filled lymphatic (Gerald, 2013). Notable to mention is the fact that confocal analysis done at this stage confirmed lymphatic lumen enlargement (Gerald, 2013). It was also revealed that there was impaired lymphatic barrier integrity in the RhoB granulation tissue (Gerald, 2013). In summary, it is important to note that loss of RhoB automatically decreases pathological angiogenesis in response to cutaneous wounding. This happens though the decrease also enhances lymphangiogenesis following both dermal wounding and inflammatory challenge (Fernandez-Borja et al., 2005). In summary, the aim of this experiment was to determine the levels of the expression of these RhoB proteins in the 3 cell lines that include MCF10 a, MDA-MB231 and MCF7.The 3 cell line had different morphology and it was expected that the difference in the expression of these RhoB proteins could be correlated to the morphology. The measurement of the expression level was through the Measurement of the RNA levels since it is directly proportional to the expressed proteins in the cells. Statement of Aims Study on this RhoB protein is not as detailed as other members of the Rho GTPase family. However, RhoB is related to vast family comprising of GTPases (RhoA/Rac1/Cdc42),has been researched and had many data published. The aim of the experiment was to obtain data that was compared with previous research. Precisely, the expression of the Rho B proteins in the 3 breast cell lines of normal, cancerous and metastatic nature was analyzed. Later there was comparison between protein expression in normal and highly invasive breast cancer. Statement of Hypothesis The Rho B expression level shows patterns and correlation between normal and cancerous tissues. In this case, higher levels of RhoB will be exhibited in the lowly metastatic cell line (MCF10a) and in comparison there is a lower level in the cell line (MDA-MB231) Ho: There is no significant difference in the expression levels of Rho B in the three cell lines H: There is a significant difference in the expression levels of Rho B in the three different cell lines 2.0. Materials and Methods Apparatus The cell culture procedure in this project required cells; disrupt tissues and the apparatus for the test. Others include the RN Easy, Buffer RPE and RT Prime mix. Cell Culture -MCF7, weakly invasive mammary cancer cells -MCF10a, non-motile non-transformed mammary epithelial cells -MDA MB 231, highly invasive mammary cancer cells The Experimental Procedure begun from Cell Culture to purification of DNA,RNA purification, cDNA construction, PCR separation, separation of PCR products on agarose gel and finally analysis of results. 2.1. Extraction and purification of RNA The method used here was the Quick Start Method (Qiagen., 2001). The following steps were followed: Step 1: A minimum of 1 * 107 cells were harvested as a cell pallet in the vessel. Appropriate amount of Buffer RLT were added together with the 350 ml and homogenized for 30 seconds. Step 2: The tissue (530 mg) was disrupted, and the lysate was homogenized in the right amount of Buffer RLT, then, the lysate was centrifuged for 3 minutes at the maximum speed. The superheated substance was carefully removed by using pipette. The lysate already homogenized was moved to a Spin column with gDNA eliminator, which was placed in a collection tube of 2 mL measurement (supplied). Step 3: Centrifugation was done for 30 minutes at speed greater than 8000 * g. The used column was carefully discarded and it was ensured that the flow-through was saved. One volume (350 ml or 600 ml) of 70 % ethanol was added to the flow through and then mixed well using pipette, making sure not to centrifuge. Immediately we moved to the forth step, step 4. Step 4: 700ml of the sample was transferred up to, including precipitate to an RN Easy Spin column placed in a 2 ml collection tube (supplied). The lid was closed and centrifuged for 15 seconds at speed greater than 8000 * g. The flow through was discarded. We then moved to step 5. Step 5: 700 Ml Buffer RW1 was added to the RNeasy using Spin Column in a 2ml collection tube. The lid was then closed and centrifuged for 15 seconds at a speed greater than 8000 * g. The flow through was discarded. We then moved to step 6. Step 6: 500 ml Buffer RPE was added to the RNEasy Spin Column. The lid was closed and centrifuged for 15 seconds at a speed greater than 8000 * g. The flow through was discarded. Then we moved to step 7. Step 7: 500ml was added to the Buffer RPE, to the RNEasy Spin Column. The lead was Closed gently and centrifuged for 15 Minutes, at a speed greater than 8000 * g (10000 *gm). An optional exercise of placing the RNEasy Spin Column in a new 2 ml collection tube supplied separately was conducted. Centrifugation was done at full speed for 1 minute to further drug the membrane. Then we moved to step 8. Step 8: The RNEasy Spin modified Column was placed in a relatively new 1.5 ml collection tube supplied separately. 30 to 50 ml was added to RNEasy free water straight to the Spin modified Column membrane. The lid was closed and centrifuged for 1 minute at a speed greater than 8000 * g (10000 * gm) to elute the RNA. An optional exercise of elating with another volume of water or RNA elate was repeated. NB: This practical had an error in the fourth step where we discarded the RNEasy Spin Column instead of the flow through. Because of this error, we joined another group to continue with the experiment. The results were very good because it gave out an exceptional yield of the RNA. The RNA was isolated and was colorless. After that, the columns were taken to the 6th floor to be measured for their concentrations and purity. 2.2. Reverse Transcriptase and Construction of cDNA library , I was able to construct a cDNA library. The kit has the capacity of eliminating the unspecific genomic DNA. The reverse Transcription PCR waundertaken as shown in the table 1below The amount of RNA used was adjusted according to the calculated concentration of the samples obtained from the previous experiment. The maximum volume allowed is 14 μl, which meant the cell line MDA-MB-231 had to be reduced as it was above 14 μl. The other cell lines were rounded to the nearest number, as the pipettes at my disposal cannot accurately measure fractions of a μl. The tubes were then incubated in a water bath at 42°C for 60 minutes ready for the next step of PCR. Table 1. Showing contents of each tube produced in cDNA construction Cell Line Calculated RNA (μl) Used RNA (μl) Reverse Transcriptase (μl) RT Buffer (μl) RT Primer (μl) RNase Free water (μl) Total Volume (μl) MCF7 1.2 1 1 4 1 13 20 MCF10a 9.7 10 1 4 1 4 20 MDA-MB 231 16.6 14 1 4 1 0 20 2.3. Polymerase Chain reaction Separation This was done as shown in the next section in order to identify the RhoB DNA in the cell lines using RhoB primers. The GAPDH clone was used as a positive control with its GAPDH primer. Table 2.Conventional PCR MCF 10 A MCF 7 MDA – MB231 A1 A2 A3 3ul Master Mix 3ul Master Mix 3ul Master Mix 5ul Forward Primer 5ul Forward Primer 5ul Forward Primer 5ul Reverse Primer 5ul Reverse Primer 5ul Reverse Primer 1ul cDNA 1ul cDNA 1ul cDNA 9ul H2O 9ul H2O 9ul H2O A4 A5 A6 3ul Master Mix 3ul Master Mix 3ul Master Mix 5ul Forward Primer 5ul Forward Primer 5ul Forward Primer 5ul Reverse Primer 5ul Reverse Primer 5ul Reverse Primer 1ul cDNA 1ul cDNA 1ul cDNA 9ul H2O 9ul H2O 9ul H2O A7 3ul Master Mix 5ul Forward Primer 5ul Reverse Primer 1ul cDNA 9ul H2O All together, the total Volume should be 25ul F = 100ul R = 100ul LABELLING KEY MCF 10 A GAPDH A1 MCF 10 A RHOB A4 MCF 7 GAPDH A2 MCF 7 RHOB A5 MDA – MB 231 GARDH A3 MDA – MB 231 RHOB A6 GAPDH CLONE A7 GAPDH CLONE should was present in all the positive control NB: We did not add 1 microliter of the MCF7 to the A5 Table 3.shows how the solutions were added in each well 1 A1 A2 A3 A4 A5 A6 A7 Do DNA bp 1 2 3 4 5 6 7 2.4. Agarose Gel Electrophoresis The Agarose gel was prepared with 50 x TAE – Pure Buffer Concentration. Add 20ulitres 1 x TAE 1 Table 4.Distance Migration and size of the PCR product fragments Buffer Concentration Distance of Migration Log 10 Fragment size 100 36 mm 2 200 31 mm 2.3 300 28 mm 2.48 400 26 mm 2.6 500 23 mm 2.7 600 The size and distance travelled on the gel by the RhoB DNA fragment was determined through the plotting of the standard curve as shown in the figure 2 below Log 10 100 BP ladder Figure 1: Standard Graph of Log 10 Fragment size against Distance of Migration Process Step 1: the distance migration of 100bp DNA ladder was measured Step 2: log 10 of each bp of DNA ladder was determined Step 3: the graph in Excel and find the equation was made Step 4: the other bands were measured Step 5: From the sequence, the sizes were then compared Step 6: The electrophoresis was got basing on the standard curve Table 5.Sequence, Distance and Log10’s Sequence Distance of the 1st Band Distance of the 2nd Band Log 10 of 1st Band Log 10 of 2nd band A1 34 - 2.12 - A2 34 mm 27 mm 2.12 2.5 A3 32 mm - 2.25 - A4 41 mm 33 mm 1.75 2.19 A5 33 mm 26 mm 2.19 2.57 A6 32 mm - 2.25 - A7 29 mm - 2.4 - 3.0 Results 3.1. The size of the RhoB protein/DNA fragment We were able to calculate the sizes of the proteins using table 5 above. This table shows the distance migrated of each sample on the gel. In this case these samples were MCF 10 A GAPDH A1, MCF 10 A RHOB A4, MCF 7 GAPDH A2, MCF 7 RHOB A5, MDA – MB 231, GARDH A3, MDA – MB 231 RHOB A6, GAPDH CLONE A7 and GAPDH CLONE. To get the size of the samples, we used the standard graph whereby we extrapolated the value of the distance migrated to get the sizes of the samples DNA fragment/Protein. The sizes that were got are summarized in the table below Table 5.Summary on the size of the samples Sample Distance migrated Size A1 MCF10 GAPDH 34 210 A2 MCF10 RhoB 34 mm 210 A3 MCF7 GAPDH 32 mm 225 A4 MCF7 RhoB 41 mm 175 A5 MDA – MB 231 GARDH 33 mm 209 A6 MDA – MB 231 RhoB 32 mm 225 A7 GAPDH clone 29 mm 240 According to the table, the mean size of the RhoB proteins or DNA fragment is 210+175 +225 =203.33bp Therefore, the mean size of the RhoB protein is 203.33bp. 3.2. The morphology of the Breast cell lines by the images that are taken in the laboratory Figure 2.The MCF10 a cell line The MCF10 is known to be normal cell line. The morphology of MCF-10A reveal cells which bear a flat monolayer form (Tait et al., 1990). The cells also differ much in size with varying shapes. Moreover, the cells are also composed of monolayers which have low cuboidal cells (Tait et al, 1990). Notable to mention is that these MCF-10A adjacent cells are more closely apposed. This has made them develop a ridge located between the cells. Figure 2.The MDA-MB231cell line. MDA-MB231 is known to be a breast cancer cell line. This cancer cell has clear epithelial like morphology which makes it poses a spindle shaped cells it has been revealed that when MDA-MB231 cells are subjected to in vitro condition, the cancer cells appear to bear an invasive phenotype (Cell biology laboratory, 2009). Moreover, it is noted that MDA-MB231 cell do grow well on agarose medium. This is an important indicator for its capability of transformation and tumerigenicity (Cell biology laboratory, 2009). The cells also exhibit relatively higher capabilities for vast colony growth efficiency. Contrary when MDA-MB231 is subjected to in vivo condition, the cells quickly form mammary pad tumors. Figure 3.The MCF7 cell line MCF7 is also a breast cancer cell line. These cells do posses the ability to form domes, more precisely when subjected to in vitro conditions. The cells also grow in monolayer fashion forming epithelial like cells.In addition to retaining their estrogen sensitivity, MCF7 cells are also known to be very sensitive to cytokeratin. Contrary to the mentioned characteristics, MCF7 can easily be inhibited from growing when subjected to tumor necrosis factor alpha (TNF alpha) (MCF7, 2013). 3.3. Result on RNA extraction and Purification Following the error committed in the fourth step, we joined another group because our results were nullified and basing on the results; MDA – MB231 had the lowest concentration of the RNA as compared to MCF10a and MCF7. The results for that group were as follows: Table 6. Concentration and purity of the extracted RNA of my Group Cell line concentration (mg / ul) Purity MCF10 A 109 2.11 MCF7 390.4 2.06 MDA – MB231 175 2.11 Table 7.The concentration and purity of RNA of the other Group Cell line concentration (mg / ul) Purity MCF10 A 103.6 2.00 MCF7 867 2.13 MDA – MB231 60.1 2.11 The optimal purity was found to be ranging between 1.8 and 2.1. 3.3. PCR Results The Rho B forward primer used was (CCACCGTCTTCGACCACTAC) and the inverted reverse primer was (TCTCGGTGGTAAATCCAGCCT). The primers were designed to produce Rho B products of 165pbp. The GAPDH forward primer used was (TGTTGCCATCAATGACCCCTT) while the reverse primer was (CTCCACGACGTACTCAGCG). The product of GAPDH was 202bp. The extracted RNA was converted to cDNA (cDNA library) with the use of Reverse Transcription PCR. The cDNA was then subjected to conventional PCR using RhoB primers. GAPDH clone was used as the positive control where the GAPDH primers were used to amplify it. The amplification was detected on the agarose gel as shown below Figure 4.showing UV Gel Image taken by the Transilluminator Figure 4 indicates the gel image whereby there is clear separation of the base pair marker that produced single bands at 100bp, 200bp and 300bp.In this case, it was possible to plot the migratory distances of the bands as well as the calibration curve as shown in figure 4 where unknown bp length were calculated using the line of best fit. The fragment migration distance was measured in millimetres and is inversely proportional to the base pair. The image limitation was the bands (primer dimmers) being visible at the end of each well. The disadvantage of these bands is that they hamper comparisons between the wells since different optical densities can be attributed to the concentrated dye or unequal sample dilutions. This factor was considered during the analysis 4.0. Discussion According to table 2, it is observed that GAPDH clone had the biggest size of 240bp.The mean size of GAPDH was estimated to be 213bp. In the table 5, it is clearly evident that GAPDH clone is the one that travelled the shortest distance on the gel (29mm) and therefore it had the biggest size of 240bp and it is indicated in the standard graph after extrapolation(fig 2) with a log of 240bp. Looking at the gel images and table 4 and table 5,for MCF10 a GAPDH and MCF10a RhoB, we can see that they have the same light intensity and also migration distance and this indicated that they have same size as well. So from this, we can say that the RhoB protein is not over expressed in MCF10a. Comment on the expression of RhoB protein in MCF7 is not possible as 1microlitre of MCF7 were not added to the wells of the agarose gel(A5) but RhoB in MDA-MB231 is expressed more compared to MDA-MB GAPDH, so this indicates they have bigger size so that they less travelled in the gel. Also when I compare MDA-MB231 RhoB to MCF7GAPDH; we can see that MDA-MB231 RhoB and MCF7 GAPDH they have same migration distance and also they have same size. So from this I predict that if we add RhoB to MCF7 in the A5 (as it was forgotton to add MCF7) then some RhoB expression in the MCF7 should be seen. GAPDH(A7) was a positive control. The mean of the GAPDH for all wells measured was 213bp so there was slight contamination as it should be 202 bp. The 100 bp ladder was used in the PCR and in order to know the size of the RhoB DNA band, a calibration or standard curve graph was drawn in Excel. The logs 10 of fragment sizes of the bands were plotted against the distance of migration taken for the band to travel (figure 2). In relation to this, it was possible to determine the size of the DNA fragment of interest (RhoB DNA fragment) through extrapolation and using the equation generated from the graph. The size of the RhoB DNA fragment was found to be 203 bp. It is well known that RNA/mRNA is directly proportional to the proteins it expresses in the cell (Adini et al., 2003). In this case, we measured the level of RNA to help us determine the level of expression of the protein of interest which is RhoB protein in the three cell lines that include MCF10 a, MCF7 and MDA – MB 231. According to the results, it is clearly evident that the three cell lines had different levels of expression of RhoB. As indicated in the results, it was not possible to determine the level of expression of RhoB proteins in MCF7 due to reasons mentioned above. In relation to the morphology, the three cell lines had different morphology and this could probably be attributed to why there was a difference in the level of RNA or differences in the expression of the RhoB proteins. According to literature, it is known that low levels of oxygen that normally persists in the tumors, can sufficiently initiate the molecular chain of events that are able to transform the breast cancer cells from being rigid as well as stationary to mobile and invasive (Blick et al., 2008). High levels of Rho proteins are known to worsen the conditions of breast cancer patients. In this regards, the Rho proteins aid the cancer cells to move and the high production of these proteins is as a result of low oxygen levels in the cancer cells (Liu et al., 2001). In order for these cells to move, the cell is required to make several changes to its internal structures as it is evident in the cell line cells above. There is always thin, parallel filaments that are formed in the cells enabling them to contract as well emergence of cellular ‘‘hands’’ that enables them to move (Huang and Prendergast, 2006). Other Rho proteins are known to be involved in the formation of these structures. The three cell lines have different levels of the expression of the RhoB, and this could be because they are either cancerous or normal. In relation to this, the MCF10 a cell line was a normal cell line but the other two cell lines were cancerous. For instance, it is expected that a normal cell line should have relatively normal levels of RhoB proteins than the metastasis stage or late stage of the cancer which has mobile cancer cells (Gibbons et al., 2009). The lower the level of oxygen concentration is, the higher the level of RhoB proteins expression (Kazerounian et al., 2013).In this case MCF10a cell line tends to have its cells adhered together; this proves that it is a normal cell line. Therefore, there is a normal expression of the RhoB proteins that is lower than those cancerous cell lines (Mazzone et al., 2009). In relation to this, it could be the main reason why it had the normal levels(not over expressed) of the RNA or RhoB protein expression as compared to these other two cell lines which tends to have the cancer cells that are scattered or spaced; hence, they could be at a metastatic stage of the breast cancer. Conclusion In conclusion, the experiment gave satisfactory results because it was able to determine different levels of RNA for RhoB in the cell lines that include MCF10 A, MCF7 and MDA – MB 231.The MCF10a which was a normal cell line had the normal levels (not over expressed) of RhoB protein, as compared to the other two cell lines that were cancerous. In regards to this, it is true because it is known that the RhoB proteins are not over expressed in normal cells as compared to the cancer cells. Also basing on the morphology, these two cancer cell lines were seen scattered, with a filamentous structure. This proves that they were cancerous cells since they were not adhered together and normally at the late stages of cancer, the cell are usually mobile and such a condition is referred to as metastasis. The morphology of the MCF10a was in such a way that the cells were adhered together, a clear sign of normal tissue/cell line. This was proved through PCR. Though this experiment was successful, it was not the appropriate one to determine the levels of expression of these RhoB proteins in these cell lines. In this case, the best option was to do western blot after extracting the protein of interest in the cells. Through this technique, it is possible to determine the level of expression of these RhoB proteins. References Adini, I., Rabinovitz, I., Sun, J. F., Prendergast, G. C. & Benjamin, L. E. (2003). RhoB controls Akt trafficking and stage-specific survival of endothelial cells during vascular development. Genes Development. 17, 2721–2732 Blick, T, et al., (2008). Epithelial mesenchymal transition traits in human breast cancer cell lines. Clin. Exp. Metastasis, 25, 629–642. Cell biology laboratory, (2009). MDA-MB-231/GFP Cell Line. Retrieved from http://www.cellbiolabs.com/sites/default/files/AKR-201-gfp-mda-231-cell line. . Fernandez-Borja, M., Janssen, L., Verwoerd, D., Hordijk, P. & Neefjes, J. (2005).RhoB regulates endosome transport by promoting actin assembly on endosomal membranes through Dia1. J. Cell Sci. 118, 2661–2670 Fritz, G. & Kaina, B.(1997). RhoB encoding a UV-inducible Ras-related small GTP-binding protein is regulated by GTPases of the Rho family and independent of JNK, ERK, and p38 MAP kinase. J. Biol. Chem. 272, 30637–30644 Gerald, D.(2013). RHoB Controls Coordination of Adult Angiogenesis and Lymphangiogenesis Following Injury By Regulating Vezf1-Mediated Transcription. Nature Communications. 4. 2824. Gibbons, D. L.(2009). Contextual extracellular cues promote tumor cell EMT and metastasis by regulating miR-200 family expression. Genes Dev. 23, 2140–2151. Huang, M. & Prendergast, G. C. (2006).RhoB in cancer suppression. Histol. Histopathol. 21, 213–218 Huang, M., Duhadaway, J. B., Prendergast, G. C. & Laury-Kleintop, L. D (2007). RhoB regulates PDGFR-beta trafficking and signaling in vascular smooth muscle cells. Arterioscler. Thromb. Vasc. Biol. 27, 2597–2605 Jahner, D. & Hunter, T (1991). The ras-related gene rhoB is an immediate-early gene inducible by v-Fps, epidermal growth factor, and platelet-derived growth factor in rat fibroblasts. Molecular. Cell Biology. 11, 3682–3690 Kazerounian, S. et al. (2013). RhoB differentially controls akt function in tumor cells and stromal endothelial cells during breast tumorigenesis. Cancer Res. 73, 50–61 Lebowitz, P. F. & Prendergast, G. C.(2005). Functional interaction between RhoB and the transcription factor DB1. Cell Adhes. Commun. 6, 277–287 (1998). Liu, A. X., Rane, N., Liu, J. P. & Prendergast, G. C (2001). RhoB is dispensable for mouse development, but it modifies susceptibility to tumor formation as well as cell adhesion and growth factor signaling in transformed cells. Mol. Cell Biol. 21, 6906–6912 Mazzone, M. et al. (2009) Heterozygous deficiency of PHD2 restores tumor oxygenation and inhibits metastasis via endothelial normalization. Cell 136, 839–851 Mcf7, (2013). MCF-7 Cells: Human Breast Adenocarcinoma Cell Line. Retrieved from http://www.mcf7.com/. Tait, L., Herbert, D & Russo, J., (1990). Ultra structural and Immunocytochemical Characterization of an Immortalized Human Breast Epithelial Cell Line, MCF-10. Cancer Research 50. 6087-6094. Read More