Nobody downloaded yet

On Target Is a for Businessmen - Book Report/Review Example

Comments (0) Cite this document
Summary
This book review analyses the book "On target" written by Laura Rowley. This paper outlines Target's strategy,  bargains, customers, Target's advertising and promotion and the way for businessmen and young entrepreneurs to achieve success…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER95.9% of users find it useful
On Target Is a Book for Businessmen
Read TextPreview

Extract of sample "On Target Is a for Businessmen"

Download file to see previous pages How come in just a blink of an eye, everything they have put up crashed down into pieces?
In this modern-day challenge of the global recession, of economic downturns, this book On Target by Rowley, Laura is a must-read book for businessmen and young entrepreneurs alike for them to learn some effective measures on establishing a business that will succeed and will endure for a lifetime. It covers topics such as distinctive differences of Target from any other retail companies; the right stuff including the merchandises on sale, store design, floor plan, and creative and visionary staff; award-winning advertising and promotions; use of media celebrities, creative designers in promoting and producing products; its philanthropic activities to schools through donations coming from percentages taken from credit card holders’ charges; and challenges that the company faces in this age of globalization and worldwide recession.
On Target is a very informative and inspiring book about a very successful retail company, “Target.” The first part of the book deals with how Target is different from any other retail department store like Wal-Mart. Rowley (p.17) mentions that Target is different from other retailers in terms of quality merchandises offered at cheaper prices; its team members’ motto, “Fast, Fun, and Friendly;” welcoming environment with easy to navigate racetrack floor plan, well-organized displays, very clean, very spacious and numerous cashiers to accommodate customers; image campaign through its award-winning distinctive advertising ads and promotional activities; its Target.direct website and Customer Relationship Management Systems whereby customers can access their database to check product price, features and customers’ evaluation; and of course its philanthropic activity of offering one percent for every purchase of customer using credit card.  These donations from credit card holders through Target go to schools. ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(On Target Is a Book for Businessmen Report/Review, n.d.)
On Target Is a Book for Businessmen Report/Review. Retrieved from https://studentshare.org/business/1722583-on-target
(On Target Is a Book for Businessmen Report/Review)
On Target Is a Book for Businessmen Report/Review. https://studentshare.org/business/1722583-on-target.
“On Target Is a Book for Businessmen Report/Review”, n.d. https://studentshare.org/business/1722583-on-target.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF On Target Is a Book for Businessmen

Target marget

...? Target Market and Adopter Groups As a Vice President of a company that will launch a new novel sports nutrition bar, one of my main tasks is to identify the target market for this product. Of course, identifying the target market is essential, for me to be able to ensure that this new sports nutrition bar would be successfully received by target consumers. In this case, for me to be able to identify my target market, I will make use of the marketing concept of “adopter groups” There are actually five different adopter groups: innovators, early adopters, early majority, late majority and laggards (“Product Diffusion Curve,” n. p.). While innovators are...
1 Pages(250 words)Essay

Target Market

...?The Market Target Market The IKEA Application (Virtual Furniture) is designed as a Multi-platform application which means that the majority of Mobile phone and Tablet users have access to the Application. The Application is intended to not only make furniture more readily available but to help minimize excess time and money spent returning an incorrect product because of incorrect dimensions or colour. The application will enhance the whole shopping experience. IKEA remains the world’s largest furniture retailer providing customers with a range of products such as garden furniture, kitchens, chairs, desks, lighting and so on. IKEA has approximately 10,000 different products to offer. IKEA doesn’t just provide its...
3 Pages(750 words)Assignment

Target Costing

...?TARGET COSTING ADVANTAGES AND DISADVANTAGES OF TARGET COSTING Alike all concepts, target costing has its own advantages and disadvantages that it offers to business upon applications. Given below is the discussion of merits and demerits of target costing: MERITS Apart from the primary benefit of planning and budgeting of the costs of project/ product before it is launched to ensure the estimation of appropriate returns; target costing offers following benefits to business: TC enables business to integrate efficient production practices such as Total Quality Management or Just in Time Inventory Systems etc. Banham (2000) discussed that strongly bonded...
4 Pages(1000 words)Essay

Target

...? Target Corporation of the of Table of Contents Introduction 3 Possible solutions to the problem 4 Conclusion 8 References 11 Introduction The modern business world is highly competitive. The main business objective of firms is to gain higher profit and take the company to better levels of business performance. In the course of doing business companies study the strategies of their competitors and try to develop superior strategies. Any company that has an edge over its competitors offers greater value to its customers than the products offered by rivals by offering lower prices or higher quality at similar prices (Wagner, 2005). Product quality plays an important role in determination of performance of companies that...
9 Pages(2250 words)Research Paper

Target plc

...?Contents Introduction 2 Financial Highlight 3 Corporate Strategy 3 Competitive Analysis 4 Competitive Advantage 4 SWOT Analysis 5 Financial Analysis7 Profitability Ratios 7 Liquidity and efficiency ratios 9 Structure Ratios 11 Conclusion 13 References 15 Introduction Target plc is one of the largest companies based in America providing food ingredients and retail and grocery solution worldwide. The study provides the details financial analysis of the company. In the case study the financial and operational evaluation of the company in questions has been undertaken. For the purpose of operational capability of the company, its corporate strategy has been analyzed in addition to the competitive environment and other risks... to which it is...
11 Pages(2750 words)Assignment

Target Markets

...be said to have been correctly targeted by the advertising campaign, and Kelly represents an instance when an experience of others instigates us to repeat it. After awareness, the next crucial step in buyers decision process is the emergence of the interest in a product or service. Surely, if this step does not occur, then buyers awareness would be useless for sellers. And of course, the real interest can emerge not just after the brief attention to catchy ads, but if the message persuades people that a product or service suits their needs. In our case, the attempt was made to reflect this stage of the decision-making process by the question about why did Greg and Kelly assume that the phone would satisfy their needs. In...
4 Pages(1000 words)Essay

Target Company

... and the philosophies (everything is relative; nothing is absolute; everything is constantly changing, so set your own morals and ethics based on the times). I would ask a recruiter the following questions: (1) What are the career opportunities for a manager and their time scale (how many years it takes to become a supervisor, etc.) (2) Does Target have special programs and benefits for young employees If so, what are they (3) Does Target propose training and development programs for career progression The main sources used for this analysis are the Companies Website and the book by Laura Rowley, (2003) "On Target'. Works Cited 1. Target. Corporation. 2007. Target: How the World's Hottest Retailer Hit a Bull's-eye John Wiley & Sons; Hoboken, New Jersey.... 13 September 2008 Employer Research Target Company is one of...
3 Pages(750 words)Case Study

Target Prediction

..., or coordinates, for “mmu-mir-223”? Answer = “mmu-mir-223” can be genetically mapped to ChrX:93438156-93438265 bp, + strand Question 1.f What is the “Stem-loop” sequence for “mmu-mir-223”? Answer = The “Stem-loop” sequence for “mmu-mir-223” is: UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG Question 1.g What is the “Mature” sequence for “mmu-mir-223”? Answer = The “Mature” sequence for “mmu-mir-223” is: >mmu-miR-223-3p MIMAT0000665 UGUCAGUUUGUCAAAUACCCCA >mmu-miR-223-5p MIMAT0017056 CGUGUAUUUGACAAGCUGAGUUG Question 2.a Using TargetScanHuman (http://www.targetscan.org/vert_50/), species set to “Mouse”, and all other search criteria kept at default settings, how many...
2 Pages(500 words)Essay

The Target

...THE TARGET Creative Personal Essay The poem, The Target, explains about a person who was in the firing squad in an event of war. This person had to shot a boy in self-defense. If he failed to shoot him, he would be the one shot by that boy and might have led to his death. The soldiers’ mother could not find any sleep, as she had no peace fearing that his son might be shot in the war and die. The soldier even goes ahead and wishes that it was better that he dies as this will ease the fears in his/ mother. After shooting that boy, thoughts about his actions start hitting his mind. He/she starts thinking what if that boy was the only son in his family. The soldier thinks what this boy’s parents would go...
5 Pages(1250 words)Essay

Leadership Skills of Businessmen

.... His people oriented leadership makes him focus on engaging employees with unquestionable integrity, and those who demonstrate ethical behavior in the workplace. Alldredge et al. (2003) argues that leaders who use such an approach for selecting their subordinates highly value trusted individuals and tend to delegate work to the people that they feel are in a capacity to accomplish targets without messing when they are not under supervision. Ellison avoids authoritarian leadership such as that of Gates. Rather, he focuses on competence as the fundamental factor to the success of Oracle. In essence, when proficiency in organizational activities is combined with ethics in the workplace, there are high possibilities of...
10 Pages(2500 words)Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Book Report/Review on topic On Target Is a Book for Businessmen for FREE!

Contact Us