Major Issues in Gene Cloning - Essay Example

Cloning the gene A). Cloning the mouse gene for G6Pase. This amino acid sequence will be checked in the mouse nucleotide collection using the TBLASTN algorithm for any match. This automatically determines the possible nucleotide sequences that could have coded for that particular amino acid sequence. After identifying an existing nucleotide sequence that can possibly produce such oligopeptide, the sequences upstream and downstream of it will be used to identify sequences compatible with restriction enzyme digestion. Upon treatment of the purified mouse DNA with restriction enzymes, the isolated DNA sequences will be joined with plasmids cut by the same restriction enzymes through their compatible and matching sticky ends, producing a recombinant DNA molecule, which will be inserted to an appropriate host cell. Plasmids can either be bacterial, viral, bacterial artificial chromosomes, yeast artificial chromosomes, or artificial cosmids, depending on the host organism of choice. Plasmids can also be classified based on its function, such that there is a certain set of vectors that can be used if the goal of the experiment is to only propagate the gene, as is the case for this particular study. However, vectors that allow expression of particular gene into the corresponding protein are also available as well. The growth in the population of host cells containing the recombinant DNA molecule will also result to the replication of the gene clone. As added optimizing measure, aside from the G6Pase sequence and restriction sites, the vector also contains resistance genes against antibiotics. Thus, those that do not have the recombinant DNA molecule will be killed by antibiotics, allowing the transformed cells to flourish better. When the clone is needed for further analysis, it can easily be extracted out of the cell (U.S. Department of Energy Genome Program, 2009). Cloning the human gene B). Using mouse gene to clone human gene It is important to note that the mouse genetic material is very similar to that of humans. Thus, a known mouse G6Pase sequence can be used in hybridization as the heterologous probe in identifying the human G6Pase (McClean, 1997). How will this work? Briefly, human DNA sample will be treated with restriction enzymes to cut the long strands into smaller fragments. After doing so, the treated extract will be run through gel electrophoresis to separate the smaller fragments by weight. Then, using the mouse gene attached to a dye as heterologous probe, the strand which contains the human G6Pase will be detected and isolated. Copies of this isolated gene can be amplified through polymerase chain reaction (PCR). Since the sequence of G6Pase is already stored in the National Center for Biotechnology Information (NCBI) database, it can be scouted to identify the most appropriate primer pair for this particular PCR. After the reaction, the amplified DNA will then be inserted to a plasmid to undergo rapid replication in preparation for further experiments on G6Pase. C). Diagram of the intron/exon structure of human G6Pase ↓ * * ↕ Figure 1. The 12.5 kb human G6Pase gene located at chromosome 17 is composed of five exons (black portions). Exon 1 runs from bases 80 – 309; exon 2 runs from bases 3134 – 3243; exon 3 runs from bases 6726 – 6831; exon 4 runs from bases 8506 – 8621 and exon 5 runs from bases 10118 – 10629. The start codon is located at exon 1 (marked by down arrow), while the stop codon is located at exon 5 (marked by double-headed arrow). The mutations discussed below are located at the regions marked by asterisks. Identification of mutations in von Gierke disease D). Sequence variation in exon 3 In wild-type, 5’ GGCACAGCAGGTGTATACTACGTGATGGTCACA 3’ is the sequence in exon 3. This translates to gly-thr-ala-gly-val-tyr-tyr-val-met-val-thr. On the other hand, the exon 3 of G6Psase of patient with von Gierke disease has 5’ GGCACAGCAGGTGTATATACTACGTGATGGTC 3’, translating to gly-thr-ala-gly-val-tyr-thr-thr-stop. Very evidently, the diseased allele contains more nucleotides in its sequence. The insertion of two nucleotide bases (T and A, highlighted yellow) resulted to a frameshift mutation, and subsequent reading of a stop codon (highlighted green). Because the mutation prematurely stops translation into functional G6Pase, what will be produced in the translation process is a string of polypeptides, which will later on be degraded by ubiquitin proteins that naturally exist in the cells to scavenge non-functional and damaged proteins. E). Sequence variation in exon 2 In wild-type, 5’ ATTCTCTTTGGACAGCGTCCATACTGGTGGGTT 3’ is the sequence in exon 2 that translates to ile-leu-phe-gly-gln-arg-pro-tyr-trp-trp-val. On the other hand, the exon 3 of G6Psase of patient with von Gierke disease has 5’ ATTCTCTTTGGACAGTGTCCATACTGGTGGGTT 3’, resulting to substitution of arginine in position 83 by cysteine: ile-leu-phe-gly-gln-cys-pro-tyr-trp-trp-val. According to Lei et al. (1995), mutation in such position leads to the loss of G6Pase activity by interfering with the formation of (His)-phosphate intermediate during G6Pase catalysis. This is because Arg-83 contributes to G6Pase activity by positioning the phosphate relative to the enzyme, while His-119 ans His-176 are the phosphoryl acceptors (Pan et al., 1998). Pattern of inheritance of von Gierke disease F). von Gierke disease is a recessive condition Because lack of this important enzyme or loss of its function is rare (1/100, 000), it is highly likely that the disease is a recessive condition. G). Likelihood of inheritance If they have another child, there is a 25% chance that the baby will have von Gierke as well. This is because for the symptoms of von Gierke to manifest, the patient must have the homozygous recessive alleles that code for the mutated G6Pase. Since the parents were able to produce an offspring with von Gierke despite not having the conditions themselves, then both parents must have been carriers of the recessive allele. In such case, the fusion of their egg and sperm during fertilization can result to an offspring with either homozygous wild-type (25%) G6Pase, G6Pase mutation carrier (50%), or homozygous recessive G6Pase (25%), which manifests as von Gierke’s disease (US National Library of Medicine, 2012). H). Primer design Before designing the primer, the desired length of PCR product should be resolved first. For the purposes of detecting a specific DNA fragment, as is the case for this procedure, 120-300 bases is sufficient. In addition, the length of the primers is an important consideration, since longer primers are more specific, while shorter primers bind to DNA easily. An optimal balance must be struck between the two, and it is suggested that 18-25 nucleotide bases is a good length to maintain specificity. In addition, PCR primers of 20 bases long should have about 50% GC content to increase efficiency of annealing. Repeats, such as ATATATA, and runs, like GGGG, should also be avoided to prevent misprimes. It should also be noted that primers should be unable to form stable secondary structures during the PCR reaction, so that the primers will have less tendency to fold on itself. On a similar note, the primers should not be complementary to each other, to prevent the amplification of primer dimers instead of the target sequence. Finally, primers designed for a sequence must not amplify other genes in the mixture. Commonly, primers are designed and then BLASTed to test for species and gene specificity (Whitehead Institute of Biomedical Research, Rozen and Skaletsky, 2007; Dieffenbach, Lowe and Dveksler, 1993). 181 cgtgatcgca gacctcagga atgccttcta cgtcctcttc cccatctggt tccatcttca 241 ggaagctgtg ggcattaaac tcctttgggt agctgtgatt ggagactggc tcaacctcgt 301 ctttaagtgg attctctttg gacagcgtcc atactggtgg gttttggata ctgactacta 361 cagcaacact tccgtgcccc tgataaagca gttccctgta acctgtgaga ctggaccagg 421 gagcccctct ggccatgcca tgggcacagc aggtgtatac tacgtgatgg Taking note of these guidelines, the following sequences (highlighted in yellow) were chosen to be primer pairs for PCR analysis. By using these primers, the PCR product will be 227 bases long, well within the 120-300 bases mentioned above. In the middle of this product will be the 5’ CAGCGT 3’ sequence (highlighted in green) needed in the PCR assay. The 23 base long forward primer will bind to the 202-224 region of the sequence, while the 20 base long reverse primer will bind to the 409-428 portion of sequence. Both primers have more than 50% GC content. Finally, when BLASTed, it was found that both primers are species and gene specific. I). Outline PCR assay of XyzI cleavage a. Amplify the particular exon 2 region through polymerase chain reaction, using the primers above. b. Run the PCR products through an agarose gel electrophoresis, and obtain the band at around 200-250 base pairs (bp). c. Treat the isolated DNA obtained from the gel with XyzI restriction enzyme. d. Run the treated DNA solution in agarose gel electrophoresis again. e. Analysis of results i. If two bands are seen instead of one, especially when these are located at around 120 bp and 100 bp, then this means that the 5’ CAGCGT 3’ is intact for both alleles. This means that the unborn child has a homozygous wild-type G6Pase. If a less stringent ladder is used, it is possible that the 100 and 120 bp-long bands will merge into one band. Thus, the unborn child will not have the disease even if one band is seen in the electrophoresis, as long as it weighs around 100-120 bp. ii. On the other hand, if only a single band at around 200-250 bp is seen, this means that XyzI was not able to cleave the sequence because the 5’ CAGCGT 3’ is absent. Such mutation was seen earlier as the mutation of this sequence into 5’ CAGTGT 3’ in von Gierke disease. This means the unborn child has a homozygous mutated allele for G6Pase, manifesting as von Gierke disease. iii. There are cases, that three bands are seen, two bands at around 100-120 bp and one band at around 200-250 bp. This happens when a heterozygous wild-type G6Pase is present. In this case, the unborn child will not manifest with von Gierke disease. J). Mutations in non-coding regions A genes non-coding regions are as important as the coding regions because they contain the genes promoter, enhancers and suppressors. The non-coding sequences of the DNA are highly conserved among various species (Downer, 2005). In such case, sequence alignment of non-spliced mRNA transcript from both normal and diseased individuals can show differences in the non-coding regions. Since these areas are supposed to be highly conserved, any variation can be a potential disease-causing mutation, and thus must be explored deeper. K). Number of carriers and how many people with the disease The Hardy-Weindberg rule is used to determine the frequency of the dominant and recessive alleles, as well as the number of diseased and carrier individuals. If we denote the dominant allele to be G and the recessive allele to be g, with the corresponding frequencies p and q, respectively, then p + q = 1. In addition, the frequency of normal, homozygous dominant individuals will be p2, the frequency of carriers (heterozygous dominant) will be 2pq, and the frequency of diseased individuals with homozygous recessive genotype will be q2 (Nature Education, 2011). Based on the given information, q2 is 1/100, 000. Getting the square root of q and using the p + q =1 equation, the frequency of recessive alleles (q) is 0.0032, and the frequency of dominant alleles (p) is 0.9968. Using these values, it can be known that twice the product of p and q is 0.9937. Therefore, in a population of 60 million, the number of diseased individuals is approximately 600, while the number of carriers (60, 000, 000 * 0.9937) is around 383, 000. REFERENCES Dieffenbach, C. W., Lowe, T. M. and Dveksler, G. S., 1993. General Concepts for PCR Primer Design. Genome Res, 3, pp. S30-S37. Downer, J., 2005. Gene regions beyond protein instructions important in disease. [online] Available at: < http://www.eurekalert.org/pub_releases/2005-04/jhmi-grb041205.php> [Accessed 27 April 2012] Lei, K. et al., 1995. Structure-Function Analysis of Human Glucose-6-Phosphatase, The Enzyme Deficient in Glycogen Storage Disease Type 1a. The Journal of Biological Chemistry, 270(20), pp. 11882-11886. Nature Education, 2011. Hardy-Weinberg Equation. [online] Available at: [Accessed 27 April 2012] Pan et al., 1998. Transmembrane Topology of Glucose-6-Phosphatase. The Journal of Biological Chemistry, 273(11), pp. 6144-6148. U.S. Department of Energy Genome Program, 2009. Cloning Fact Sheet. [online] Available at: [Accessed 27 April 2012] U. S. National Library of Medicine, 2012. If a genetic disorder runs in my family, what are the chances that my children will have the condition? [online] Available at: [Accessed 27 April 2012] Whitehead Institute of Biomedical Research, Rozen, S. and Skaletsky, H., 2007. Primer-BLAST. [online] Available at: [Accessed 27 April 2012] Read More