StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Biological Identifications Through DNA Bar Codes - Lab Report Example

Cite this document
Summary
The author of the paper "Biological Identifications Through DNA Bar Codes" discusses the use of DNA segments to yield a more accurate taxa and species classification. The quality of the sample DNA dictates the effectiveness of the DNA barcoding process…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER97.9% of users find it useful
Biological Identifications Through DNA Bar Codes
Read Text Preview

Extract of sample "Biological Identifications Through DNA Bar Codes"

The protocol utilizes short sequences of organisms to characterize them. These oligonucleotides fall in positions in the genome that are agreed upon and standard for a particular genome of interest. The DNA barcode sequences are also rather short in comparison to the entire genome and can be extracted with relative ease utilizing cheap methods.  For instance, the cytochrome C oxidase sub-unit 1 mitochondrion region (COI) has in recent times been the standard barcode region for higher animals. One defines the characteristic of the DNA barcode as its commonality within a species (within species) and variation among species (without species). ie for a selected DNA barcode of a particular species there exists ranging differences and these differences are minor in individuals of the same species to guarantee the sequence segment to be used as a barcode.

Besides being used as markers of water quality in freshwater bodies, mayflies (Insecta: Ephemeroptera ) are important food sources for freshwater fish.

DNA Barcoding Protocol

In obtaining the DNA for barcoding, the mayfly should be killed in a ‘DNA-friendly fashion’ by avoiding the use of preservation agents such as formalin which may degrade DNA.  Genomic DNA is isolated via the fast DNA extraction method from fresh or frozen specimens. A combination of Chelex protocol with Proteinase K may rule out the need for tissue disruption while guaranteeing the release of DNA chitinous material left intact. PCR amplification is done with an optimal primer specific to the barcode region. The barcode products obtained from the PCR are in most instances sequences bidirectional and later deposited in the barcode reference library. This bidirectional sequence eliminates the difficulties encountered near the end of the reads.

Results:

BLAST  results: FASTA format for the top 2 matches

Sequence  JF287131.1:

>gi|325653673|gb|JF287131.1| Ephemerella subvariants voucher 08-SWRC-0922 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial

ACTTTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTGGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGGTTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGAGCTGTGAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT

 

Sequence two JF287129.1;

>gi|325653669|gb|JF287129.1| Ephemerella subvariants voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial

ACTCTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTAGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGATTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGGGCTGTAAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT

The top two matches in the BLAST database

Accession number     sequences name                                 E value           query coverage

  1. 1 Ephemerella subvaria                             0.0                      100%     

voucher 08-SWRC-0728       

cytochrome oxidase

subunit 1 (COI) gene,

partial cds; mitochondrial

  1. 1 Ephemerella subvaria                        

voucher 08-SWRC-0728                         0.0                    100%                       

cytochrome oxidase

subunit 1 (COI) gene,

partial cds; mitochondrial

The top two matches in  the BOLD database

Table 1: the first two results of the species level match made by sample #3 in the BOLD database

Phylum

            class

order

Family

Genus

Species

Specimen similarity (%)

Arthropoda

Insecta

Ephemeroptera

Ephemerellidae

Ephemerella

Bavaria

100

 

Arthropoda

Insecta

Ephemeroptera

Ephemerellidae

Ephemerella

Bavaria

100

 

Discussion:

Invertebrates vary in their populations and are diverse. This warrants a more accurate and systemic classification of the species as they are identified. DNA barcoding provides a novel system structured to provide rapid and accurate species identification by use of short, standardized gene regions as species tag rather than the use of phenotypic or morphological identifiers which in some organisms such as invertebrates may be tedious and cumbersome to identify. Barcoding presents a myriad of benefits to ecologists and conservationists in achieving their goals. of identifying the habitats and niches of invertebrates such as Mayflies and also seeking to identify sequences threatened by changes in their environments.

Mayflies are a common feature in undisturbed freshwater bodies and are utilized by biomonitoring teams in establishing water quality (Bauernfeind and Moog, 2000).

There was a match in the taxonomic ID and BOLD ID as evidenced by the BOLD and BLAST results. In some cases, matches may fail to occur particularly when the sample is contaminated with DNA from other sources. These contaminants ultimately distort the outcome of the BLAST resulting yielding misleading results. False positives may also occur in queries done in the BOLD database where closely allied congeneric species which have not yet been established in the identification tree may appear in the results thereby Resulting in a misleading classification of the organism of interest.

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“DNA Barcoding Lab Report Example | Topics and Well Written Essays - 750 words”, n.d.)
Retrieved from https://studentshare.org/biology/1591464-dna-lab-report-2
(DNA Barcoding Lab Report Example | Topics and Well Written Essays - 750 Words)
https://studentshare.org/biology/1591464-dna-lab-report-2.
“DNA Barcoding Lab Report Example | Topics and Well Written Essays - 750 Words”, n.d. https://studentshare.org/biology/1591464-dna-lab-report-2.
  • Cited: 0 times

CHECK THESE SAMPLES OF Biological Identifications Through DNA Bar Codes

Advantages and Disadvantages of DNA Fingerprinting

the fingerprints which are formed from the genetic bar codes helps in identifying individuals.... dna FINGERPRINTING Name University dna FINGERPRINTING dna which is the Deoxyribonucleic acid is basically a chemical structure that makes chromosomes, one piece of chromosome which shows one specific trait is known as gene.... dna is basically double helix and it is made up of two strands of genetic material which is spiraled around one another ....
2 Pages (500 words) Essay

Forensic Science: DNA Evidence

"dna analysis promises to be the most important tool for human identification since Francis Galton developed the use of fingerprints for that purpose".... (Committee on dna Forensic Science, 1996).... dna identification is one of the most valuable instruments for the contemporary criminologists.... If the database would be created that would contain the genetic samples of every dweller of our planet, the offender would be found in couple of hours or even minutes after the crime "Any type of organism can be identified by examination of dna sequences unique to that species"....
5 Pages (1250 words) Essay

Biotechnological Applications of Cultivated and Uncultivated Marine Microorganism

It is either achieved through the direct enumeration technique and other modern filter techniques.... For instance, biosurfactant producing marine bacteria can be studied through haemolytic assay (HA), modified drop collapse (MDC), tilted glass slide, oil spread method (OSM), blue agar plate(BAP), emulsification index(EI) and emulsification assays.... Munn showed that the study of the community structure and the allocation of function to different groups of microorganisms could be achieved through microelectrodes and biosensor methods....
14 Pages (3500 words) Assignment

The Development from Child to Adolescent

nurture argument has a broader application in behaviorist conditioning, Freudian neurosis, or the DSM related psychological disorders as they arise through conditioning, genetics, and other factors.... In the paper 'The Development from Child to Adolescent' the author explains the six different concepts to describe the development from child to adolescent....
14 Pages (3500 words) Dissertation

Discuss about DNA related topic

The complexities of the human body including the structure, dna has come a long way since the time of the famous photo 51 of Rosalind Franklin until the three-dimensional model interpretation of Jim Watson and Francis Crick of the double helical structure of the dna strand.... Even the discovery of the dna helix was of controversy itself as discussed in an interview of Lynn Osman Elkin conducted on March 26, 2003 posted at NOVA website regarding the confusion on who to take credit for the discovery, if double helix dna should be more on Franklin's account (Rosalind Franklins Legacy)....
6 Pages (1500 words) Essay

DNA Barcoding Invertebrate Lab Report #1

In dna barcoding, usually a.... In the second stage, laboratory analysis which involves extraction of genetic material to obtain dna batcode sequence is done.... These sequences are later Biology Topic: lab report on dna barcoding Introduction: dna barcoding provides a versatile tool for ification of organism based on dna taxonomy and delimitation and ‘discovery' of new species.... In dna barcoding, usually a four staged approache is engaged....
2 Pages (500 words) Lab Report

Misuse of DNA in Homicide Cases

This article discusses the investigation method of purifying dna from contaminated and degraded forensic samples, in respect to Polymerase Chain Reaction (PCR).... In this investigation, it was found that at time, dna which is taken from bloodstains has the copurified impurity.... This discussion has really helped me to understand how The National Commission on the Future of dna was established by the National Institute of Justice (NIJ) in 1998, courtesy of Janet Reno, who was then the attorney general....
5 Pages (1250 words) Annotated Bibliography

Common Assessment Topics

orrection of an abnormality in a tumor suppressor gene can be accomplished using gene therapy by inserting a copy of the wild-type gene into the dna.... This work called "Common Assessment Topics" describes the various diseases and their main characteristics.... The author outlines gene therapy for cancer, the role of paternity testing....
9 Pages (2250 words) Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us