Biological Identifications Through DNA Bar Codes - Lab Report Example

The protocol utilizes short sequences of organisms to characterize them. These oligonucleotides fall in positions in the genome that are agreed upon and standard for a particular genome of interest. The DNA barcode sequences are also rather short in comparison to the entire genome and can be extracted with relative ease utilizing cheap methods.  For instance, the cytochrome C oxidase sub-unit 1 mitochondrion region (COI) has in recent times been the standard barcode region for higher animals. One defines the characteristic of the DNA barcode as its commonality within a species (within species) and variation among species (without species). ie for a selected DNA barcode of a particular species there exists ranging differences and these differences are minor in individuals of the same species to guarantee the sequence segment to be used as a barcode.

Besides being used as markers of water quality in freshwater bodies, mayflies (Insecta: Ephemeroptera ) are important food sources for freshwater fish.

DNA Barcoding Protocol

In obtaining the DNA for barcoding, the mayfly should be killed in a ‘DNA-friendly fashion’ by avoiding the use of preservation agents such as formalin which may degrade DNA.  Genomic DNA is isolated via the fast DNA extraction method from fresh or frozen specimens. A combination of Chelex protocol with Proteinase K may rule out the need for tissue disruption while guaranteeing the release of DNA chitinous material left intact. PCR amplification is done with an optimal primer specific to the barcode region. The barcode products obtained from the PCR are in most instances sequences bidirectional and later deposited in the barcode reference library. This bidirectional sequence eliminates the difficulties encountered near the end of the reads.

Results:

BLAST  results: FASTA format for the top 2 matches

Sequence  JF287131.1:

>gi|325653673|gb|JF287131.1| Ephemerella subvariants voucher 08-SWRC-0922 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial

ACTTTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTGGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGGTTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGAGCTGTGAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT

Sequence two JF287129.1;

>gi|325653669|gb|JF287129.1| Ephemerella subvariants voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial

ACTCTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTAGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGATTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGGGCTGTAAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT

The top two matches in the BLAST database

Accession number     sequences name                                 E value           query coverage

1. 1 Ephemerella subvaria                             0.0                      100%     

voucher 08-SWRC-0728       

cytochrome oxidase

subunit 1 (COI) gene,

partial cds; mitochondrial

2. 1 Ephemerella subvaria                        

voucher 08-SWRC-0728                         0.0                    100%                       

cytochrome oxidase

subunit 1 (COI) gene,

partial cds; mitochondrial

The top two matches in  the BOLD database

Table 1: the first two results of the species level match made by sample #3 in the BOLD database

Phylum

            class

order

Family

Genus

Species

Specimen similarity (%)

Arthropoda

Insecta

Ephemeroptera

Ephemerellidae

Ephemerella

Bavaria

100

Arthropoda

Insecta

Ephemeroptera

Ephemerellidae

Ephemerella

Bavaria

100

Discussion:

Invertebrates vary in their populations and are diverse. This warrants a more accurate and systemic classification of the species as they are identified. DNA barcoding provides a novel system structured to provide rapid and accurate species identification by use of short, standardized gene regions as species tag rather than the use of phenotypic or morphological identifiers which in some organisms such as invertebrates may be tedious and cumbersome to identify. Barcoding presents a myriad of benefits to ecologists and conservationists in achieving their goals. of identifying the habitats and niches of invertebrates such as Mayflies and also seeking to identify sequences threatened by changes in their environments.

Mayflies are a common feature in undisturbed freshwater bodies and are utilized by biomonitoring teams in establishing water quality (Bauernfeind and Moog, 2000).

There was a match in the taxonomic ID and BOLD ID as evidenced by the BOLD and BLAST results. In some cases, matches may fail to occur particularly when the sample is contaminated with DNA from other sources. These contaminants ultimately distort the outcome of the BLAST resulting yielding misleading results. False positives may also occur in queries done in the BOLD database where closely allied congeneric species which have not yet been established in the identification tree may appear in the results thereby Resulting in a misleading classification of the organism of interest.