Free

DNA Barcoding Invertebrate #1 - Lab Report Example

Comments (0) Cite this document
Summary
Sequences that are used as barcodes are usually those that are unique and conserved within a species. In DNA barcoding, usually a…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER97.9% of users find it useful
DNA Barcoding Invertebrate Lab Report #1
Read TextPreview

Extract of sample "DNA Barcoding Invertebrate #1"

Biology Topic: lab report on DNA barcoding Introduction: DNA barcoding provides a versatile tool for ification of organism based on DNA taxonomy and delimitation and ‘discovery’ of new species. Sequences that are used as barcodes are usually those that are unique and conserved within a species. In DNA barcoding, usually a four staged approache is engaged. The first stage is to obtain a specimen which may be from from tissue or culture collections. In the second stage, laboratory analysis which involves extraction of genetic material to obtain DNA batcode sequence is done. These sequences are later placed in a barcode database such as the Barcode intiative to be used as species identifiers to assign unknown specimens to known species. Currently two such databases exists, the Barcode of life (BOLD) and The International Nucleotide Sequence Database Collaborative which is an intiative of the three main Nucleotide databases, GenBank, EMBL and DDBJ. The fouth and final stage is to carry out an analysis where specimens are identified with the closest matching reference record in the aforementioned databases.
In this lab report, we sought to perform a barcode analysis using mayfly DNA sequences in the BOLD database. The barcode sequence is mainly a short DNA sequence which has a uniform location in the genome and is used to identify species. One of the commonly used sequence in DNA barcoding is the cytochrome oxidase subunit 1 (COI). This was the sequence we used this work. The barcoding process involves identifying a universal locus which has retained enough sequence conservation throughout evolution and can be sourced from many organisms. This sequence should also be diverse so as to be competent enough to differentiate a target species to the family level. Generally regions of the chloroplast (rbcL gene) and the mitochondria (COI) meet these requirements. Various studies have been undertaken by Herbert et al (2003a, 2004b) and established this COI sequence as the sequence of choice in DNA barcoding in insects and vertebrates. Inverterbrates such as mayfly are collected whole and may be euthanized in a kill jar by placing them in a freezer. In the lab, primers are designed to target the conserved regions flanking the rbcL or the COI regions.
Examples of the barcoding primers which may be used in insects
5-GTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG-3 (forward primer - LepF1_t1)
5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG-3 (forward primer - VF1_t1)
5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG-3 (forward primer - VF1d_t1)
5-TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG-3 (forward primer - VF1i_t1)
5-CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA-3 (reverse primer - LepR1_t1)
5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA-3 (reverse primer - VR1d_t1)
5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA-3 (reverse primer - VR1_t1)
5-CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA-3 (reverse primer - VR1i_t1)
These primers should be able to accommodate degeneracy occurring in the conserved regions as a result of evolutionary processes such as the ‘genetic drift’.
Results:
BLAST results:FASTA format for the top 2 matches
Sequence JF287131.1:
>gi|325653673|gb|JF287131.1| Ephemerella subvaria voucher 08-SWRC-0922 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
ACTTTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTGGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGGTTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGAGCTGTGAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT
Sequence two JF287129.1;
>gi|325653669|gb|JF287129.1| Ephemerella subvaria voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial
ACTCTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTAGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGATTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGGGCTGTAAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTT
The top two matches in the BLAST database
Accession number sequences name E value query coverage
1. JF287129.1 Ephemerella subvaria 0.0 100%
voucher 08-SWRC-0728
cytochrome oxidase
subunit 1 (COI) gene,
partial cds; mitochondrial
2. JF287129.1 Ephemerella subvaria
voucher 08-SWRC-0728 0.0 100%
cytochrome oxidase
subunit 1 (COI) gene,
partial cds; mitochondrial
The top two mathces in the BOLD database
Table 1: the first two results of the species level match made by sample #3 in the BOLD database
Phylum
class
order
Family
Genus
Species
Specimen similarity (%)
Arthropoda
Insecta
ephemeroptera
Ephemerellidae
Ephemerella
Subvaria
100
Arthropoda
Insecta
ephemeroptera
Ephemerellidae
Ephemerella
Subvaria
100
Discussion:
Insects are diverse in nature and present an interesting opportunity for a host of target groups such as taxonomist, conservationists and ecologists. The coming into place of the DNA technology and its bulging potential has revolutionarized the classification of organisms from the morphological perspective to a more advanced DNA taxonomy which requires DNA barcoding. It provides a novel sytem structured to provide a rapid and accurate species identification by use of short, standardized gene regions as species tag. Mayfly are a common feature in undisturbed freshwater bodies and are utilized by biomonitoring teams in establishing the water quality (Bauernfeind and Moog, 2000).
A match in the taxonomic ID and BOLD ID as evidenced by the BOLD and BLAST results. In some cases matches may fail to occur particularly when the sample is contaminated with DNA from other sources. These contaminants ultimately distort the outcome of the BLAST resulting yielding misleading results. False positives may also occur in queries done in the BOLD database where closely allied congeneric species which have not yet been established in the identification tree may appear in the results thereby resulting to a misleading clasification of the organism of interest.
References
Bauernfeind, E. and Moog, O. (2000). Mayflies (Insecta: Ephemeroptera) and the assessment
of ecological integrity : a methodological approach. Hydrobiologia 422:71-83
Hebert, P. D. N., A. Cywinska, S. L. Ball, and J. R. Dewaard. (2003a). Biological identifications
through DNA bar codes. Proceedings of the Royal Society of London B Biological Sciences 270: 313–321.
Hebert P.D.N., Stoeckle M.Y, Zemlak T.S., Francis C.M. (2004b). Identification of Birds
through DNA Barcodes. PLoS Biol 2: e312. Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“DNA Barcoding Invertebrate Lab Report #1 Example | Topics and Well Written Essays - 500 words”, n.d.)
Retrieved from https://studentshare.org/biology/1591455-dna-barcoding-invertebrate-lab-report-1
(DNA Barcoding Invertebrate Lab Report #1 Example | Topics and Well Written Essays - 500 Words)
https://studentshare.org/biology/1591455-dna-barcoding-invertebrate-lab-report-1.
“DNA Barcoding Invertebrate Lab Report #1 Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/biology/1591455-dna-barcoding-invertebrate-lab-report-1.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF DNA Barcoding Invertebrate Lab Report #1

Obesity

5 Pages(1250 words)Essay

Agarose Gel Electrophoresis of DNA

...is quantified. (Clark and Pazdernik 2012). The Bands on the gel are visualized using the intercalating fluorescent dye, Ethidium bromide. When the Agarose gel dyed with EtBr is visualized in the ultra violet rays (UV rays), we can observe the bands. The Ethidium Bromide is a florescent dye that gets illuminated under the UV light. When UV light of wavelengths 260, 300 and 360 nm are used, the DNA bands can be observed very efficiently almost to the concentration of 1 nanogram. Ethidium Bromide binds to the intercalating planar group between the base pairs of nucleic acid. This method is very efficient as it can detect the dsDNA concentration as low as 1 nanogram. (Robertson, Ross and...
5 Pages(1250 words)Lab Report

Dna, transposable elements, pv92 insertion, evolution, bioinformatics, hardy weinberg equation

...the entire human genome. It is not yet known what function they play as well as their origin (Olson et al., 1989).These Alu sequences are known to possess characteristics that are critical to the geneticists. They are usually present within introns of a given genes, and they might be associated either with a disease or can be utilized in the estimation of relatedness between and among individuals (Deininger, 1989). In this experiment, there was analysis of a single Alu repeat and it was utilized in the estimation of its frequency in the class population as well as a basic molecular genetic variation measure. This was with no reference to relatedness between individuals or to disease. Figure 1 indicates the types of...
4 Pages(1000 words)Lab Report

DNA Restriction and Electrophoresis

...DNA Restrictions and Electrophoresis Purpose: Electrophoresis is a method used to separate DNA molecules by sized restrictions are the enzymes used to prepare DNA for analysis or other manipulations. Here we examine the genotypic analysis of DNA using restriction enzymes and gel electrophoresis. Method: Three samples of DNA are extracted from bacteriophageand purified. These Purified samples of DNA number 48,502 base pairs in length. These samples are now segregated into four and are incubated at 37 combined individually with three different restriction endonucleases and the fourth sample, which is used, as a negative control does not...
4 Pages(1000 words)Lab Report

DNA Practical

...migration of the tracking dyes. After adequate migration, DNA fragments are visualized by ethidium bromide. This is a fluorescent dye and it intercalates between the bases of DNA and RNA. It is incorporated in the gel so that staining occurs during electrophoresis. Bands appear on the gel and can be visualized. Results: Part 1 A fluffy white layer was formed at the boundary between the green and the purple liquids when the ethanol was added. It was made up of fine filaments. Part 2 After putting the electrical current, strands of the DNA become visible to the naked eye. It becomes like stains, or bands, on the gel. Discussion NaCl removes protein and carbohydrate in...
4 Pages(1000 words)Lab Report

DNA Barcoding

...(COI) gene, partial cds; mitochondrial The top two mathces in the BOLD database Table 1: the first two results of the species level match made by sample #3 in the BOLD database Phylum class order Family Genus Species Specimen similarity (%) Arthropoda Insecta ephemeroptera Ephemerellidae Ephemerella Subvaria 100 Arthropoda Insecta ephemeroptera Ephemerellidae Ephemerella Subvaria 100 Discussion: Invertebrates vary in their populations and are diverse. This warrants for a more accurate and systemic classification of the species as they are identified. DNA barcoding provides a novel sytem structured to provide a rapid and accurate species identification by use of...
3 Pages(750 words)Lab Report

Lap 1

... Lap Report1 – Seven Dimension Of Wellness Wellness in humanity means more than the absence of symptoms and their related diseases, but it is fully appreciating and experiencing life without challenges. Notably, it involves all the process of living, achieving, and growing in life so that an individual can maximally experience potential to being well being; hence, wellness is living life to the fullest without any form of intolerance (Hoeger, Werner, and Hoeger 12). Wellness in defining humanity are sub categorized in seven major dimensions upon which each dimension is fully defined and described. These dimensions include physical wellness, mental wellness, emotional wellness, spiritual wellness, occupational wellness, social... Lap Report1 – ...
1 Pages(250 words)Lab Report

Lab 4 Infectious Bacterial Identification from DNA

...strand from the bacterium, use the Microbial DNA kit to identify a DNA strand in the bacterium then add a little culture with some Carlsbad solution. Leave the DNA strand for a few minutes at a constant temperature of 360C then add 0.9 cm3 of oxynucleoside triphosphate to amplify the DNA strand that has been extracted. Finally, add 1 cm3 of culture to all the DNA strands from different blood samples that have undergone the above procedures to identify the Burkholderia cepacia bacterium from other similar bacteria that cause cold. Result The Burkholderia cepacia bacterium becomes purple when culture is added to a DNA...
1 Pages(250 words)Lab Report

Writing a protocol for genomic DNA extraction and PCR

...that is further optimized for the Taq polymerase. Standard PCR reaction Component Final concentration volume PCR grade ddH2O - 2.5 μL) 10x PCR buffer , Mg 1x 0.75 μL) 50 mM mgCl2 1.5 mM 0.5 μL) 10mM d NTP mixture 0.2 m M each 1.25 μL) 10 μM reverse primer PC02 0.5 μM 1.25 μL) Template DNA1-500ng Varies Taq DNA polymerase (5 U/μL) 1.0 u/rxn 0.1 μL) Procedure The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues and blood samples of patients . blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol...
4 Pages(1000 words)Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Lab Report on topic DNA Barcoding Invertebrate Lab Report #1 for FREE!

Contact Us