Free

Identification of GMO foods using PCR - Lab Report Example

Comments (1) Cite this document
Summary
In the laboratory, we performed DNA isolation on food products (soy beans) and amplification of the DNA was done by polymerase chain reaction (PCR) on soy beans food DNA in order to detect the presence of genetic modification…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER93.8% of users find it useful
Identification of GMO foods using PCR Lab Report
Read TextPreview

Extract of sample "Identification of GMO foods using PCR"

Running head: GMOs Identification of GMOs using PCR College: In the laboratory, we performed DNA isolation on food products (soy beans) and amplification of the DNA was done by polymerase chain reaction (PCR) on soy beans food DNA in order to detect the presence of genetic modification. The genetically modified reference standards were used as controls and the samples were analyzed using agarose gel electrophoresis. GMOs was not identified in all of our soy beans samples with PCR method, we rejected our null hypothesis that stated GMOs was present in our soy beans samples. Introduction Genetically modified foods are ever appearing in the news. While on the other hand, genetic modifications have improved several crops that include increasing the yields. There are many groups of people who have raised protest against “tinkering” with crop plants (FDA. 2000). However, In the U.S.A., The introduction of these genetically modified foods to the market has been with little fanfare. Most parts of the world have been experiencing increasing and strong resistance to any genetically modified foods introduction to the market place. The European Union together with other countries usually need certification on foods entering their countries and this should be Genetically Modified Organism (GMO) free ( DG JRC,1998). Testing of the food products is done to confirm the presence of GMOs. Occasionally, food contamination occurs or food testing is inaccurate and this results to the presence of GMOs in foods. PCR is one the methods used to test for GMOs in food products, whereby the band presence shows that there are GMOs. The PCR principle is to multiply specific DNA sequences, so that they can be detected. This method that is highly sensitive offers the advantage to detect the molecules of DNA that are more thermo stable than proteins (Arakawa et al, 1998). The efficiency of confirmation, identification and screening strategies is supposed to be examined with respect to false-positive rates, increased use of specific regulator sequences, marker genes disappearance and the increasing GM foods in number (Clark et al, 2002). In the lab, the GMOs presence in conventional soy beans samples was tested by PCR. The null hypothesis was; there is GMOs in the soy beans. Methods The experiment objective as indicated earlier was to use the PCR method to identify genetically modified foods in the soy beans. Firstly, the DNA was isolated from the soy beans samples. This was done by weighing about 50-100 mg of the sample and later it was transferred to a test tube. 400 ?l of extraction buffer was added to the tube then the tube contents were mashed with a micro-pestle. The test tubes were later incubated at 56°C for about an hour. The test tubes were removed out and 300?l of NaCl solution was added. The contents of the tube were mixed for about 30 seconds by vortexing, later the tube was centrifuged for about 15-30 minutes. The supernatant was then removed from the tube. It was then transferred to a fresh tube. 100% isopropanol equal volume was added to the new test tube. This was incubated until the next lab period in the freezer. After this, the test tubes were spinned at 4°C for about 20 minutes. Later, the supernatant was removed from the pellet of which the pellet was washed appropriately with 1.5 ml of 70% ethanol. The pellet was allowed to completely dry while the alcohol was discarded. The pellet of DNA was later dissolved in 300 ?l of 1xTE buffer, then placed on ice until the time the PCR was ready. The samples were then prepared for PCR; making sure the PCR reaction pellet was at the tube bottom and the tube was labeled. Preparation of PCR reaction mix was done by adding 5 ?l of DNA template for amplification and 20 ?l of primer mix was added to the pellet. Mixing was done until the pellet was dissolved. The tubes were then put in an automatic thermal cycler. Initial denaturation was at 94°C for 10 min, 50 cycles for 1 min at 94°C, 63°C for 1 min, and 72°C for 1 min, and the final extension was for 10 minutes at 72°C. After the final PCR stage, 5 ?l of 10x gel loading solution was added to the sample. This was stored on ice until the process of agarose gel electrophoresis. The agarose gel electrophoresis was then done after which the viewing of the bands was done and the data was then collected. Results According to the PCR results, there was no band in lane 4 as shown in the figure below In the negative control lane, there was no band or DNA fragment except there were bands below 50bp which were artifacts of the primers. The bands of 195bp were also observed There was also no band of 195bp at 0% control standard lane. Figure showing electrophoresis results Discussion No DNA fragment is expected to appear in the lane of negative control except bands at or below 50bpwhich are usually primers’ artifacts. 195bp bands show that there is CaMV35S promoter. Also the DNA fragments of 195bp should not appear in the lane of 0% control standard. A fragment of 195bp should appear in the lane of 2% control standard. The samples may or may not indicate a band at 195bp but for the soy bean sample, the band never appeared. Theoretically, an organic food product is required to be free from genetically modified foods. However, the definitions of organic vary. If a product shows that it is 100% organic, it is expected to have no band. Non-organic foods products might probably have detectable levels of genetically modified food. Conclusion In conclusion, the findings never supported hypothesis that there is presence of GMOs in the soya beans. Further studies or research should be done to really ascertain that there is no GMOs in the soy beans. These results are unusual because it is expected that non-organic foods should have some traces of GMOs. This is according to literature. Bibliography Arakawa, T., D.K.X. Chong, and W.H.R. Landridge. (1998). Efficacy of a food plant-based oral cholera toxin B subunit vaccine. Nature Biotechnology 16(3): 292. Clark, D. and L. Russell. (2000). Molecular Biology Made Simple and Fun. Vienna, IL: Cache River Press, pages 218-220. DG JRC.(1998). Directorate Generals European Commissions Joint Research Centre,Environment Institute, Consumer Protection & Food Unit. Screening method for the identification of genetically modified organisms (GMO) in food. FDA. (2000). U. S. Food and Drug Administration Center for Food Safety & Applied Nutrition. Foods Derived from New Plant Varieties Derived through Recombinant DNA Technology. Online: http://vm.cfsan.fda.gov/~lrd/biocon.html Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Identification of GMO foods using PCR Lab Report”, n.d.)
Retrieved de https://studentshare.org/biology/1495441-identification-of-gmo-foods-using-pcr-lab-report
(Identification of GMO Foods Using PCR Lab Report)
https://studentshare.org/biology/1495441-identification-of-gmo-foods-using-pcr-lab-report.
“Identification of GMO Foods Using PCR Lab Report”, n.d. https://studentshare.org/biology/1495441-identification-of-gmo-foods-using-pcr-lab-report.
  • Cited: 0 times
Comments (1)
Click to create a comment or rate a document
el
elizabethzieman added comment 11 months ago
Student rated this paper as
At first, I thought 3 of pages is too much for such a issue. But now I see it could not be done smarter. As the author starts you see the depth of the question. I’ve read all at once. Wonderful paper

CHECK THESE SAMPLES OF Identification of GMO foods using PCR Lab Report

Isolation and identification of unknown bacteria

...of multiresistent bacteria that are not responcive to a range of antibiotics it becomes necessary to identify the exact causative agent in order to identify the most effective antibiotic treatment (Bennett 2008). Identification of bacteria is also important in cases of food poisoning, infective diarhoea and other gastrointestinal diseases because by identifying the bacteria we can find the reservoir and the mechanism of contamination and therefore prevent any further morbidity and contamination. In our present project we will receive a pure culture of unknown bacteria and using the techniques and procedures that we learned in the lab we will try to identify the underlying microorganism....
11 Pages(2750 words)Lab Report

Identification the Stages of C elegans

...Laboratory 1 Material Required: Mutant worms on NGM-lite plates Wild-type worms on NGM-lite plates Binocular dissecting microscope Methods: 1. LAB1-part 1- Plates with wild worms are seen under microscope and behavior is observed. Life stage of microscope and drop on plate to induce movement. Tapping the plate may also be required to induce movement. Observation of lifecycle is made. 2. LAB1-part 2 Both mutant and wild types are observed under microscope and morphological and locomotor differences between them are observed and recorded. LABROATORY 2 E. coli are used as the food source for C. elegans. C. elegans are propagated on lawn of E coli on NGM-lite medium. The worms are propagated from plate to...
5 Pages(1250 words)Lab Report

Biochemical identification of unknown bacteria

...performed. These include nitrate utilization, catalse and oxidase. Results were found to be Negative for nitrate utilization and oxidase while it was found to be positive for catalase, confirming the presence of E coli in given unknown sample. Conclusion: Identification of given sample was carried out using different morphological and biochemical investigations. Standard chart was used for various tests for comparison of results. Nutrient slant and nutrient agar plate used for colony morphology studies where organism found to be grown as white, translusion, convex, and without any pigmentation. These results have indicated presence of E coli or Enterobacter...
4 Pages(1000 words)Lab Report

Viral Genome Detection Using Polymerase Chain Reaction

...chain reaction in food microbiology. Journal of Microbiological Methods 23: 89-103 Cicek et al. 2007. Comparison of the “ProDect BCS RV CHIP” assay with the combination of shell vial cell culture and immunofluorescence antibody test for the detection of respiratory viruses. Journal of Virological Methods. 143: 161–168 Lee et al. 2009. Rapid detection and identification of 12 respiratory viruses using a dual priming oligonucleotide system-based multiplex PCR assay. Journal of Virological Methods 156: 111–116 Lesnikova et al. 2010. Rapid, sensitive, type specific PCR detection of the E7 region of human papillomavirus type 16 and 18 from paraffin...
4 Pages(1000 words)Lab Report

Market Opportunity Identification

...Market Opportunity Identification Introduction Wotif.com is one of the leading online travel and accommodation services companiesin the world. The company has grown from its humble as a startup in a garage in 2000 to become a global company with offices in various countries (Norman 2012). In its quest for expansion and new international markets, Wotif.com has to look at the Asian region. Specifically, China offers a potential market for the company’s expansion plans in order to assert its position as an international online travel service provider. This market identification report will deliver an environmental analysis of the Chinese online travel market by evaluating the macro and micro business...
10 Pages(2500 words)Lab Report

Detecting Cry1Ab gene in Mon0810 Transgenic Maize by PCR

...). Principles and technical aspects of PCR amplification. [Dordrecht], Springer. PLA, M., et al. (2012). New Multiplexing Tools for Reliable GMO Detection. 333-366. VALDÉS, A., & GARCÍA-CAÑAS, V. (2013). MS-Based Methodologies for Transgenic Foods Development and Characterization. 191-220. WALSH, MARIA C., BUZOIANU, STEFAN G., GARDINER, GILLIAN E., REA, MARY C., GELENCSÉR, EVA, JÁNOSI, ANNA, EPSTEIN, MICHELLE M., ROSS, R. PAUL, & LAWLOR, PEADAR G. (n.d.). Fate of Transgenic DNA from Orally Administered Bt MON810 Maize and Effects on Immune Response and Growth in Pigs. Public Library of Science. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3223173.... College Explain how it can detect Cry1Ab gene in Mon810 Transgenic Maize By...
1 Pages(250 words)Lab Report

Biochemical identification-qualitative analysis

...Qualitative identification of biochemical elements present in various compounds Sunday, 11 September Qualitative identification of biochemical elements present in various compounds Abstract This experiment was aimed to identify various elements present in various compounds. In the experiment, present of calcium ions, chloride ions, reducing sugars, polysaccharides, lipids, carbohydrates, amino acids, nucleic acids and peptides tests were done using various methods which include diphenylamine test, biuret test, Ninhydrin test, Sudan dye test, Benedict’s test, I2 – KI test, and mineral tests. Introduction Different compounds contain different elements. Each of the element in these...
4 Pages(1000 words)Lab Report

Lab 4 Infectious Bacterial Identification from DNA

...Infectious Bacterial Identification from DNA Sequencing Infectious Bacterial Identification from DNA Sequencing Other ways of identifying bacteria such as Grahm staining and Ziehl-Neelsen staining which use staining of the bacteria using a special dye prove to be inefficient in comparison to genetic testing method that use DNA sequencing. Genetic testing has an advantage over the other methods due to its ability to identify the species that a bacterium belongs to rather than identifying only its genus. DNA sequencing involve identifying the DNA sequence of a bacterium then multiplying the DNA strands using the polymerase reaction that generate a lot of DNA strands for testing to note variations in different species (Witkowski 2005... ...
1 Pages(250 words)Lab Report

Identification of unknown

...Laboratory Report: Identification of Unknown Bacterial Culture Introduction The use of diagnostic bacteriology has made it possible to identify unknown bacterial cultures from clinical and environmental materials based on their metabolic or biochemical characteristics. Specific enzyme function and cellular respiration of a bacteria is key in the identification process. Before performing the experiment one should have adequate knowledge in staining methods, isolation techniques, microbial nutrition, biochemical characteristics and general characteristics of microorganisms to be able to identify the unknown bacteria. It is vital to differentiate the bacterial culture in order to make...
4 Pages(1000 words)Lab Report

Writing a protocol for genomic DNA extraction and PCR

...By The of the The of the School The and where it is located The Protocol Title: to study the protocol for DNA extraction and PCR basing on the methods sections Materials, reagents and equipment The following reagents and materials were used in the process. 10 μM stocks of Lambda primers, PC01: Forward-5’, GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5’-GGTTATCGAAATCAGCCACAGCGCC-3’’, template: bacteriophage lambda DNA (0.3 μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP, dTTP, dGTP, dCTP), 50 mM Mg SO4, PCR grade water , PCR tubes, Nuclease free pipet tips with cotton, filters clean lab mat (Maria & Frank ,...
4 Pages(1000 words)Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Lab Report on topic Identification of GMO foods using PCR Lab Report for FREE!

Contact Us