StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Sequence Analysis - Essay Example

Comments (0) Cite this document
Summary
Most of these computer algorithms string use dynamic programming in their implementation. According to Giegerich, (2000), dynamic programming…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER98.1% of users find it useful
Sequence Analysis
Read TextPreview

Extract of sample "Sequence Analysis"

Download file to see previous pages Sequences alignment is one of the pillars of bioinformatics and is the process of comparing two or more sequences to deduce whether they are related to one another. In this comparison, one may draw inferences as to whether two proteins for instance have similar function, contains similar structural motifs which are the conserved sequences with a protein sequence that correspond to structural or functional regions. Sequence alignment is used to determine whether two or more sequence display sufficient similarity.
This similarity must be sufficient to infer homology. Usually in sequence alignment; two terms are prominent, homology and similarity. Similarity is a measure and can be measured for instance the percentage identity and homology can never be measured and it is the conclusion drawn from the similarity data to infer whether any two genes or gene product being compared share a common evolutionary history.
Homology may be defined as a putative conclusion which is reached after examining optimal alignment between two sequences and assessment of their similarity. Homology between two sequences is not measured in degrees and it implies evolutionary relationship. Homology may be classified as either orthologs which are genes separate by speciation event (s) and they may have similar structural domains and function. Paralogs sequences may be genes separated by duplications events and may provide insight on novel genes arising from duplication event adapting to modified cellular functions.
Sequence alignment may either be local or global. Global sequence alignment compares two sequences along their entire length whereas local sequence alignment finds the most similar regions in two sequences being aligned. Albeit slow the dynamic programming algorithms are more accurate compared to the heuristic algorithms, FASTA and BLAST (Polyanovsky, et al., 2011). BLAST and FASTA algorithms are the ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Sequence Analysis Essay Example | Topics and Well Written Essays - 1500 words”, n.d.)
Retrieved from https://studentshare.org/miscellaneous/1609808-sequence-analysis
(Sequence Analysis Essay Example | Topics and Well Written Essays - 1500 Words)
https://studentshare.org/miscellaneous/1609808-sequence-analysis.
“Sequence Analysis Essay Example | Topics and Well Written Essays - 1500 Words”, n.d. https://studentshare.org/miscellaneous/1609808-sequence-analysis.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Sequence Analysis

Candide El Dorado sequence

...Candide El Dorado Sequence The significance of Candide Eldorado The episode in Eldorado is significant in many spheres. The author uses Eldorado to depict an utopian world. This is an ideal society that is remarkably the epitome of human aspirations. The lives of the Eldorado’s are idealistic and simplistic in nature. The journey by Candide and his compatriot Cacambo has over the time been rough. They have gone through variants of societal evils clearly illustrated in the narrative of the author. In Eldorado, the situation presented suggests hope to humanity. Candide and Cacambo are appreciated in this strange land. Their host, the king and the old man together personify the goodness inherent in all human beings....
5 Pages(1250 words)Essay

Product Development Sequence

...Product Development Sequence ‎ In order to develop new products, the organizations have now recognized the importance of rapid and punctual developments and the improvement of time performances. As the business world rushes the competitive use of emerging technologies and developing new products, the organizations involve in the process of new product development. Studies show that the lesser the time the new product takes to develop, the lesser the time it will take to grow and establish. The time performance of the product development is very important as it suggests the organizations to reduce the time taken for the development of the product from the initial stage till it reaches to the customer. However, there are a number... ...
4 Pages(1000 words)Research Paper

Sequence Diagram Flight Reservation System

...?Sequence Diagram – Flight Reservation System A Sequence diagram in the words of Janssen available at Techopedia: “A sequence diagram, in the contextof UML, represents object collaboration and is used to define event sequences between objects for a certain outcome.” (Janssen, 2010) A Sequence Diagram consists of actors (identified in the use case diagram), system, and their interaction (sequence of actions) with respect to time. The sequence diagram is a critical part utilized in procedures of analysis and design documentation of user requirements. The sequence diagram is a tool of Unified Modelling Language (UML) that represents the interaction of different actors with the system in order to get a result/response (Bell, 2004... ). The...
3 Pages(750 words)Assignment

Rapid Sequence Intubation

...Rapid Sequence Intubation (Patient with bleeding tonsillitis) Number of words 316 Rapid Sequence Intubation (Patient with bleeding tonsillitis) Tonsillectomy is one of the most common surgical procedures performed. Over 144000 such surgeries have been performed in the US alone. One of the most feared complications of this surgery includes post surgical bleeding. About 1% -4% of patients are reported to have a complications related to bleeding after tonsillectomy. As the bleeding causes obstruction of airway passage, tubulation is indicated. Rapid Sequence Intubation (RSI) is a commonly used technique for managing airway emergencies. The technique involves tabulating the patient along with the use of anaesthetics, muscle relaxants... with...
10 Pages(2500 words)Essay

DNA sequence analysis, primer design, protein expression and mutagenesis assessment

...The first step in identifying the protein d for by the 6 frame sequence interpreted below from the gel sample, was to approach the data from the 5’ to the 3’ end. It is a given that stop codons will be involved as well as an open reading frames with no stop codons. Bottom: ttctgatcctcaattaattaatatctcatggtttggcta ttgatgatagcaacaaacaaagattttacgagggattgatac aagtgtggggtgtgtttcatatcttaggacatgatcttttt ctgggtcatctaggccaatatagtggaaagctgtctgttg tttgagatgggtattgttttggactatggtttgaacagc Tagaaactcttctttggttaaaggg 227 Top From this nucleotide data obtained from a traditional gel electrophoresis, it can be ascertained that the following amino acids are coded for: Origin 1 maqnslrlve dksvdkskal eaalsqiers fgkgsimklg snenvvevet vstgslsldi... ...
6 Pages(1500 words)Essay

DNA Sequence Analysis

...DNA Sequence Analysis DNA Sequence Analysis Cloning EL784663 In cloning the general cloning protocol is followed, the step followed includes the production of the primer. However for our case the primers to be selected are generated online. The next step involves the insertion of the pUC18 with the appropriate restriction enzymes. This process has to take place at a specific location so that the cut ends of the DNA will stick together. The next process in which we have to do is putting the linearizer pUC18 and the inserts together with an enzyme called DNA ligase. The last stage involves the transformation into the required competent cells. Open reading frames (ORFs)...
6 Pages(1500 words)Coursework

Film Analysis of final sequence in Se7en

... Introduction to screen analysis Movie: Se7en (1995) Introduction-The movie Se7en was made in 1995 which featured Morgan Freeman, Bratt Pitt and Gwyneth Paltrow. The movie here is discussed from a film art perspective. The genre of the film is crime, thriller, and drama. In the last scene from 1:56.00 - 2.00.00, the two detectives and the serial killer “John Doe” arrive at the location, which is an isolated desert area far-off from the city. A delivery van draws near and Somerset stops the driver, leaving Mills and Doe by themselves. The courier guy hands over a wrapped up box which he was told to deliver at exactly this time and place. While Mills is controlling Doe at gunpoint, Doe talks about how much he admires Mills, but does... will be...
8 Pages(2000 words)Essay

Communication - Monroe's Motivated Sequence

...Monroe’s Motivated Sequence Monroe’s Motivated Sequence in Michelle Obama’s Speech Attention - The First Lady started herspeech by quoting President Obama as saying: “The challenges we face are unprecedented; and that we need to build a new foundation for economic growth in America.” Quoting the President and using “we” are effective strategies in acquiring the attention of the listeners, because it becomes apparent that the issue concerns them. Need - After saying that the administration is doing its part of the job, the First lady states: “But we cannot do this alone here in Washington. Economic recovery is as much about what you’re doing in your communities as what we’re doing here in Washington; and...
2 Pages(500 words)Assignment

Persuasive speech; Motivated sequence

...Hunger amidst plenty Lecturer: Food crisis worsens in West Africa, Southern Africa food shortages worsen, millions of people are at risk of drought in East Africa, Africa drought sparks food shortages these are the headlines we wake up to every morning across all major news networks. From the CNN to the BBC we read them on New York Times, the Washington post, the Herald. These headlines are often accompanied by pictures of malnourished children and women begging for food and water. The problem of food shortage cuts across sub Sahara Africa affecting states in West, East, Central and Southern Africa (Associated press, 33). With countries like Angola, Burundi, Lesotho, Mozambique, Malawi, Zambia and many others always... amidst plenty...
2 Pages(500 words)Essay

Discovery of a New Gene and Analysis of the Encoded Protein

... Report on the discovery of a “new” gene and analysis of the encoded protein Abstract The DNA sequence of the hypothetical new gene (Type II membrane serine like protease) was analyzed to determine the encoded protein and the order of bases in the DNA. The first step in the nucleotide sequence analysis was the translation of the DNA sequence to allow for the identification of open reading frame. Next, the translated peptide of the new gene was then compared with the existing nucleotide database to deduce the possible amino acid sequence of the nucleotides, suggest the likely function of the nucleotide sequence of the...
8 Pages(2000 words)Coursework
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Essay on topic Sequence Analysis for FREE!

Contact Us