Nobody downloaded yet

Job opportunity in bioinformatics - Term Paper Example

Comments (0) Cite this document
Summary
Bioinformatics is an indispensable, interdisciplinary science that deals with the development of software and tools for studying and understanding biological data. It involves the fields of computer science, statistics, mathematics, and engineering. It combines these areas to…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER95.2% of users find it useful
Job opportunity in bioinformatics
Read TextPreview

Extract of sample "Job opportunity in bioinformatics"

Download file to see previous pages Bioinformatics is, therefore, an extensive field with many job opportunities both directly and indirectly linked to it. This paper presents some of the employment opportunities.
The first job opportunity that bioinformatics presents are sequence analysis. Sequence analysis was first done in 1977 when the phage Φ-X174 was sequenced. The job involves decoding DNA sequences and storing the information in databases. The sequence analysts then analyze the data to find out the genes that code for proteins and other structures in the sample. This has led to the discovery that comparing the genes within organisms of the same species, or different species reveal similarities in the functionality of their proteins. However, the growing amounts of data, means that it is no longer possible to analyze DNA sequences manually. Sequence analysts have, therefore, developed software that search the genome of millions of organisms, consisting of billions of nucleotides in databases (Levine 4). The programs can make up for mutations in DNA sequences, so that they can determine related but identical sequences. A variation of the sequence alignment is used in the sequencing process. The shotgun sequencing technique gives the series of thousands of small DNA structures. It produces the sequence data quickly but does not assemble the fragments quite fast for complicated genomes. Another job area of bioinformatics in sequence analysis is in the automatic search for genes and regulatory sequences within genomes. However, nucleotides found in genomes are not all genes. Bioinformatics is vital in bridging the gap between genome and proteome projects like in using DNA sequences for identifying proteins (Levine 5).
Bioinformatics knowledge is required for a job in genome annotation. Genome annotation is the process of marking the genes and the other biological features in DNA sequences. Owen White designed the first ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Job opportunity in bioinformatics Term Paper Example | Topics and Well Written Essays - 1250 words”, n.d.)
Job opportunity in bioinformatics Term Paper Example | Topics and Well Written Essays - 1250 words. Retrieved from https://studentshare.org/information-technology/1670772-job-opportunity-in-bioinformatics
(Job Opportunity in Bioinformatics Term Paper Example | Topics and Well Written Essays - 1250 Words)
Job Opportunity in Bioinformatics Term Paper Example | Topics and Well Written Essays - 1250 Words. https://studentshare.org/information-technology/1670772-job-opportunity-in-bioinformatics.
“Job Opportunity in Bioinformatics Term Paper Example | Topics and Well Written Essays - 1250 Words”, n.d. https://studentshare.org/information-technology/1670772-job-opportunity-in-bioinformatics.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Job opportunity in bioinformatics

Bioinformatics assignment

...?School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOUR PROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are related to the material in Section B. Task 8 is to be found in Section C and uses the peptide sequence that was allocated to you. Marks are shown in parentheses. Task 1 (no marks) Write down the peptide sequence (near the start of section...
4 Pages(1000 words)Assignment

Bioinformatics and gestational diseases

...these genes could allow a statistical determination of risk as well as a codification of the risk factors [5]. Therefore, this paper will look at the current accepted statistical determinants surrounding preeclampsia and what is currently known regarding the genetic risk factors. Materials and Methods A search was done on Google Scholar for the keywords “preeclampsia” and the alternative spelling “pre-eclampsia” and the phrase “preeclampsia risk”, also with the alternative spelling. Precedence was given to those results that were located in journals with the words “bioinformatics”, “statistics”, or “molecular” in the titles, though this was not completely exclusive. This was done in order to obtain studies in the field...
6 Pages(1500 words)Lab Report

Bioinformatics

...? Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database work 26th October Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene. 1) Using NCBI BLAST identify the most likely candidate for the complete gene. a. What is the name of the gene? Homo sapiens prion protein (PRNP) gene Gene ID: 5621 PRNP Query coverage of 100% E value of 2e-21 – [BLASTN 2.2.27+] (Zhang et al., 2000) b... Health...
6 Pages(1500 words)Assignment

Bioinformatics and molecular modelling

...?Bioinformatics and Molecular Modelling Bioinformatics and Molecular Modelling Part I and II Introduction Lipases are glycerol esters that often act on the triacylglycerols so that they cab release glycerol and acids. The major part of the lipases are used in industrial processes today are stemmed from animal or microbial sources. Notably, plant enzymes have some advantages over animals and microbial enzymes since they are available from natural sources with low costs and ease of purification. They widely exist in plant and microbial species, but with poor characterization of structure. Plant lipases are often considered to be involved in regulating certain plant growths and developments (Bos and...
8 Pages(2000 words)Essay

Bioinformatics

...- How would the mutation affect the coding sequence of the gene Mutations create variation within the gene pool. Less favorable (or deleterious) mutations can be reduced in frequency in the gene pool by natural selection, while more favorable (beneficial or advantageous) mutations may accumulate and result in adaptive evolutionary changes. Mutation is generally accepted by the scientific community as the mechanism upon which natural selection acts, providing the advantageous new traits that survive and multiply in offspring or disadvantageous traits that die out with weaker organisms. Changes in DNA caused by mutation can cause errors in protein sequence, creating partially or completely non-functional proteins. To function... How would the...
6 Pages(1500 words)Essay

Bioinformatics in cancer therapy

...Running Head: Research Proposal Research Proposal [Institute's Research Proposal Introduction Since few decades, medical science has advanced and progressed rapidly that has enabled physicians, therapists, surgeons, etc in carrying out their processes in an easy and efficient manner. Bioinformatics is one of the major indications of scientific achievements that are now contributing enormously to the field of medical science as well (Chinnaiyan, pp. 22-24, 2005). Experts (Coleman, pp. 161-63, 2004) have indicated that since few years, biological data has become a significant piece of information used by medical experts to understand different variations and sequences of patients, essential for understanding patient's...
8 Pages(2000 words)Research Proposal

Bioinformatics research

...Introduction There is ocean of data available in various database generated from genome projects worldwide. In almost all organism most of the genome contains valuable information pertaining to a specific function or mere data that has not been deciphered. In the recent decades, advancements in the field of molecular biology coupled with Information technology enabled rapid sequencing of large genome data sets. Bioinformatics utilizes methods from applied mathematics, informatics, statistics, and computer science to solve complex biological problems. Biological databases have become integral resources in assisting scientists to understand and interpret biological phenomena. Bioinformatics deals with data management in genomics... and...
21 Pages(5250 words)Dissertation

Bioinformatics

...proteins EFR29682.1 a hypothetical protein from Anopheles darlingi it had an E value of 10. This protein is not in any way related to Down syndrome. This is a protein from mosquito saliva and matches by chance. This E value is high; its significance is low in relation to Down syndrome (Pevsner 7). Protein 2 is EGW12244.1 known as Down syndrome critical region protein 3–like from Chinese hamster (Cricetulus griseus). This protein has an E value of 1 and is related to Down syndrome since the E value is very low. The hamster genome is similar to the human genome (Pevsner 15). Protein 3 was XP_002122877 with an E value of 0.4 it is a protein predicted to be similar to Down syndrome critical region protein 3 (Down syndrome critical region...
1 Pages(250 words)Lab Report

Opportunity

...Opportunity Every new day is an opportunity, a new day present a chance to make new achievements and at the same time make changes where necessary. As human being we will never be complete and therefore each passing second present as with a chance and opportunity to shape and our lives to the desired levels and hence the world. As students, we have bigger roles and responsibilities not only to ourselves but also to the entire community. As American students we have bigger roles since the country and the society over expects from us. The country has global responsibilities and therefore the responsibilities and expectations of American students extend beyond the national boundaries....
4 Pages(1000 words)Essay

Advanced Bioinformatics

...Bioinformatics as a Key Facilitator of Scientific Research of Learning Bioinformatics as a Key Facilitator of Scientific Research Nowadays the world opens numerous perspectives for development of different activities and fields. Bioinformatics is being developed at a full pace currently and this science facilitates the process of data processing in the field of biology. Different complicated issues and challenges in biology can be solved by means of this science. In spite of the fact that this field occurred in 1970, at our present time it opens huge prospects for development of biology. Moreover, on the background of a rapidly developing science, there are many...
4 Pages(1000 words)Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Term Paper on topic Job opportunity in bioinformatics for FREE!

Contact Us