Nobody downloaded yet

Advanced Bioinformatics - Essay Example

Comments (0) Cite this document
Summary
Bioinformatics is being developed at a full pace currently and this science facilitates the process of data processing in the field of biology. Different complicated issues and…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER96% of users find it useful
Advanced Bioinformatics
Read TextPreview

Extract of sample "Advanced Bioinformatics"

Download file to see previous pages Bioinformatics is mainly directed on facilitation of ideas and obtained data. Biological research turns into an interesting and not a really hard task, when computer deals with information processing. These days bioinformatics is focused on answering the following questions: a question about new genes, protein functioning, finding the difference between healthy cell genes and cancer cells genes etc. As far as we can see, these global biological issues are solved from a quite different perspective. Bioinformatics reconsiders previous approaches and methods used in biology, and make them more advanced and modern, while there is a combination with computer science and information techniques.
There are some exact benefits of bioinformatics in the face of the coming age. For example, various diseases are treated in an innovative way, protein function is considered in details nowadays, innovative drugs and medicine are on the way to discovery, microarrays are applied for diagnosis, genetically modified foods occupy its niche in the modern market and so on. All these benefits and innovative visions and approaches are mediated by means of bioinformatics. It is relevant to look beyond the initial objective of bioinformatics, which was focused on biological data analysis only. Nowadays this scientific field includes many other studies, such as genomics, gene expression studies, structural biology, etc. (Luscombe, p. 356)
Biological processes should be processed by means of computation and this can be explained in the following way: the experiments focused on design of biological data or application of innovative technology in the field of data mining are mediated and facilitated by computational methods and approaches for sure (National Center for Biotechnology Information, 2004) .
Drug discovery is the issue of crucial importance nowadays. The leading pharmaceutical companies are operating on ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Advanced Bioinformatics Essay Example | Topics and Well Written Essays - 1000 words”, n.d.)
Advanced Bioinformatics Essay Example | Topics and Well Written Essays - 1000 words. Retrieved from https://studentshare.org/miscellaneous/1604833-advanced-bioinformatics
(Advanced Bioinformatics Essay Example | Topics and Well Written Essays - 1000 Words)
Advanced Bioinformatics Essay Example | Topics and Well Written Essays - 1000 Words. https://studentshare.org/miscellaneous/1604833-advanced-bioinformatics.
“Advanced Bioinformatics Essay Example | Topics and Well Written Essays - 1000 Words”, n.d. https://studentshare.org/miscellaneous/1604833-advanced-bioinformatics.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Advanced Bioinformatics

Bioinformatics assignment

...?School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOUR PROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are related to the material in Section B. Task 8 is to be found in Section C and uses the peptide sequence that was allocated to you. Marks are shown in parentheses. Task 1 (no marks) Write down the peptide sequence (near the start of section...
4 Pages(1000 words)Assignment

Bioinformatics and gestational diseases

...these genes could allow a statistical determination of risk as well as a codification of the risk factors [5]. Therefore, this paper will look at the current accepted statistical determinants surrounding preeclampsia and what is currently known regarding the genetic risk factors. Materials and Methods A search was done on Google Scholar for the keywords “preeclampsia” and the alternative spelling “pre-eclampsia” and the phrase “preeclampsia risk”, also with the alternative spelling. Precedence was given to those results that were located in journals with the words “bioinformatics”, “statistics”, or “molecular” in the titles, though this was not completely exclusive. This was done in order to obtain studies in the field...
6 Pages(1500 words)Lab Report

Personal Statement for Bioinformatics Graduate Program

...Davis Veterinary School in 2009-2010, I became deeply aware of the vast amount of medical information stored and retrieved by accessing a database. This personal experience of the power and efficacy of computers impressed on me the importance of technology as a tool in research. I discovered that the hands-on processing of data gives me immense satisfaction. Gradually, my earlier interest in science and research shifted focus from the traditional bench sitting to a computer oriented approach. Therefore, in my junior year of college, I declared my major as Biotechnology, with a Bioinformatics option that combined my interests in both technology/informatics and biology/genetics. The Applied Bioinformatics...
4 Pages(1000 words)Personal Statement

Bioinformatics

...? Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database work 26th October Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene. 1) Using NCBI BLAST identify the most likely candidate for the complete gene. a. What is the name of the gene? Homo sapiens prion protein (PRNP) gene Gene ID: 5621 PRNP Query coverage of 100% E value of 2e-21 – [BLASTN 2.2.27+] (Zhang et al., 2000) b... Health...
6 Pages(1500 words)Assignment

Bioinformatics and molecular modelling

...?Bioinformatics and Molecular Modelling Bioinformatics and Molecular Modelling Part I and II Introduction Lipases are glycerol esters that often act on the triacylglycerols so that they cab release glycerol and acids. The major part of the lipases are used in industrial processes today are stemmed from animal or microbial sources. Notably, plant enzymes have some advantages over animals and microbial enzymes since they are available from natural sources with low costs and ease of purification. They widely exist in plant and microbial species, but with poor characterization of structure. Plant lipases are often considered to be involved in regulating certain plant growths and developments (Bos and...
8 Pages(2000 words)Essay

Bioinformatics

...- How would the mutation affect the coding sequence of the gene Mutations create variation within the gene pool. Less favorable (or deleterious) mutations can be reduced in frequency in the gene pool by natural selection, while more favorable (beneficial or advantageous) mutations may accumulate and result in adaptive evolutionary changes. Mutation is generally accepted by the scientific community as the mechanism upon which natural selection acts, providing the advantageous new traits that survive and multiply in offspring or disadvantageous traits that die out with weaker organisms. Changes in DNA caused by mutation can cause errors in protein sequence, creating partially or completely non-functional proteins. To function... How would the...
6 Pages(1500 words)Essay

Bioinformatics in cancer therapy

...Running Head: Research Proposal Research Proposal [Institute's Research Proposal Introduction Since few decades, medical science has advanced and progressed rapidly that has enabled physicians, therapists, surgeons, etc in carrying out their processes in an easy and efficient manner. Bioinformatics is one of the major indications of scientific achievements that are now contributing enormously to the field of medical science as well (Chinnaiyan, pp. 22-24, 2005). Experts (Coleman, pp. 161-63, 2004) have indicated that since few years, biological data has become a significant piece of information used by medical experts to understand different variations and sequences of patients, essential for...
8 Pages(2000 words)Research Proposal

Bioinformatics research

...Introduction There is ocean of data available in various database generated from genome projects worldwide. In almost all organism most of the genome contains valuable information pertaining to a specific function or mere data that has not been deciphered. In the recent decades, advancements in the field of molecular biology coupled with Information technology enabled rapid sequencing of large genome data sets. Bioinformatics utilizes methods from applied mathematics, informatics, statistics, and computer science to solve complex biological problems. Biological databases have become integral resources in assisting scientists to understand and interpret biological phenomena. Bioinformatics deals with data management in genomics... and...
21 Pages(5250 words)Dissertation

Bioinformatics

...proteins EFR29682.1 a hypothetical protein from Anopheles darlingi it had an E value of 10. This protein is not in any way related to Down syndrome. This is a protein from mosquito saliva and matches by chance. This E value is high; its significance is low in relation to Down syndrome (Pevsner 7). Protein 2 is EGW12244.1 known as Down syndrome critical region protein 3–like from Chinese hamster (Cricetulus griseus). This protein has an E value of 1 and is related to Down syndrome since the E value is very low. The hamster genome is similar to the human genome (Pevsner 15). Protein 3 was XP_002122877 with an E value of 0.4 it is a protein predicted to be similar to Down syndrome critical region protein 3 (Down syndrome critical region...
1 Pages(250 words)Lab Report

Job opportunity in bioinformatics

...Job Opportunity in Bioinformatics Bioinformatics is an indispensable, interdisciplinary science that deals with the development of software and tools for studying and understanding biological data. It involves the fields of computer science, statistics, mathematics, and engineering. It combines these areas to obtain biological data, analyze it and come up with new biological information. It then uses the biological information to create universal perspective that the entire humanity can subscribe to. Bioinformatics uses information storage and data analysis in computer science to deal with the massive amounts of information on the decoded genes (Levine 3)....
5 Pages(1250 words)Term Paper
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Essay on topic Advanced Bioinformatics for FREE!

Contact Us