StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Assignment-Synthesis of a Protein - Lab Report Example

Cite this document
Summary
The beginning sequence can be identified using the start codon. The start codon is typically AUG in eukaryotes (or ATG in DNA; this also encodes methionine). In addition to AUG, alternative start codons, mainly GUG and UUG are used in prokaryotes. The yellow highlighted ones…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER93.7% of users find it useful
Assignment-Synthesis of a Protein
Read Text Preview

Extract of sample "Assignment-Synthesis of a Protein"

Sequence A: TCTTCCCTCCTAAACGTTCAACCGGTTCTTAATCCGCCGCCAGGGCCCCGCCCCTCAGAAGTTGGT DNA: TCT/TCC/CTC/CTA/AAC/GTT/CAA/CCG/GTT/CTT/AAT/CCG/CCG/CCA/GGG/CCC/CGC/CCC/TCA/GAA/GTT/GGTmRNA:UCU/UCC/CUC/CUA/AAC/GUU/CAA/CCG/GUU/CUU/AAU/CCG/CCG/CCA/GGG/CCC/CGC/CCC/UCA/GAA/GUU/GGU66 nucleotides1 UCUUCCCUCC UAAACGUUCA ACCGGUUCUU AAUCCGCCGC CAGGGCCCCG 51 CCCCUCAGAA GUUGGUNote: The numbers 1 and 51 represent the nucleotide positions. Example, at position 51, the nucleotide base is C or CytosineWhen codons 24 to 66, including codons 66 are removed, the sequence reads,UCUUCCCUCCUAAACGUUCAACC UCU/ UCC/ CUC/ CUA/ AAC/ GUU/ CAA/ CC Amino acid sequence: Serine (S)/ Serine (S)/ Leucine (L)/ Leucine (L)/ Aspargine (N)/ Valine (V) / Glutamine (Q)Therefore, resulting protein sequence is,SSLLNVQSequence B: TCAGACGTTTTTGCCCCGTAACAACTTGTTACAACATGGTCATAAACGTCAGAGATGGTCATGAATCTCTTAACTDNA: TCA/GAC/GTT/TTT/GCC/CCG/TAA/CAA/CTT/GTT/ACA/ACA/TGG/TCA/TAA/ACG/TCA/GAG/ATG/GTC/ATG/AAT/CTC/TTA/ACTmRNA:UCA/GAC/GUU/UUU/GCC/CCG/UAA/CAA/CUU/GUU/ACA/ACA/UGG/UCA/UAA/ACG/UCA/GAG/AUG/GUC/AUG/AAU/CUC/UUA/ACU75 nucleotides1 UCAGACGUUU UUGCCCCGUA ACAACUUGUU ACAACAUGGU CAUAAACGUC 51 AGAGAUGGUC AUGAAUCUCU UAACUWhen codons 24 to 66, including codons 66 are removed, the sequence reads,UCAGACGUUU UUGCCCCGUA ACACUCUUAA CUUCA/ GAC/ GUU/ UUU/ GCC/ CCG/ UAA/ CAC/ UCU/ UAA/ CUAmino acid sequence: Serine (S)/ Aspartic acid (D)/ Valine (V) /Phenylalanine (F) / Alanine (A) / Proline (P)/ STOP CODON/Histidine (H)/ Serine (S)/ STOP CODONTherefore, resulting protein sequence is,SDVFAP.HS.(.

= stop codon)Sequence C: TACAAAAAGACCTCACATGTAACACCCCAACTCCGCGTGAAGAACCAAACAGCGATACCGCTCCCGAAAAAGATATGGGDNA: TAC/AAA/AAG/ACC/TCA/CAT/GTA/ACA/CCC/CAA/CTC/CGC/GTG/AAG/AAC/CAA/ACA/GCG/ATA/CCG/CTC/CCG/AAA/AAG/ATA/TGG/GmRNA:UAC/AAA/AAG/ACC/UCA/CAU/GUA/ACA/CCC/CAA/CUC/CGC/GUG/AAG/AAC/CAA/ACA/GCG/AUA/CCG/CUC/CCG/AAA/AAG/AUA/UGG/G79 nucleotides 1 UACAAAAAGA CCUCACAUGU AACACCCCAA CUCCGCGUGA AGAACCAAAC 51 AGCGAUACCG CUCCCGAAA AAGAUAUGGGWhen codons 24 to 66, including codons 66 are removed, the sequence reads,UACAAAAAGA CCUCACAUGU AACAAA AAGAUAUGGGUAC/ AAA/ AAG/ ACC/ UCA/ CAU/ GUA/ ACA/ AAA/ AGA/ UAU/ GGGAmino acid sequence: Tyrosine (Y)/ Lysine (K)/ Lysine (K) /Threonine (T) / Serine (S) / Histidine (H)/ Valine (V)/ Threonine (T) / Lysine (K) / Arginine (R)/ Tyrosine (Y)/ Glycine (G)Therefore, resulting protein sequence is,YKKTSHVTKRYGAnalysis Answers:1.

The beginning sequence can be identified using the start codon. The start codon is typically AUG in eukaryotes (or ATG in DNA; this also encodes methionine). In addition to AUG, alternative start codons, mainly GUG and UUG are used in prokaryotes. The yellow highlighted ones are the start codons.2. The end sequence can be identified using either one of the three the stop codons namely, UAA (Ochre), UAG (Amber), UGA (Opal). The blue highlighted ones are the stop codons.3. The translated protein of Sequence A (SSLLNVQ) contains 7 amino acids.

The translated proteins of Sequence B (SDVFAP.HS.) contain 6 and 2 amino acids respectively. The translated protein of Sequence C (YKKTSHVTKRYG) contains 12 amino acids.4. If a particular protein was absent, it would lead to errors in protein synthesis. Errors in protein synthesis disrupt cellular fitness, cause disease phenotypes, leads to loss of function of the protein (non-functional proteins) and protein misfolding. Protein misfolding destabilizes membranes and induces chronic stress.

Errors in protein synthesis produce polypeptides displaying a gain of toxic function which may confer an alternate or pathological function on a normal, folded protein. In case of enzymes, the hydrophobic core provides structural stability for the molecule and amino acid changes may result in unstable protein product that is temperature sensitive. As the catalytic site of the enzyme is extremely sensitive, a single point mutation (either a deletion or insertion or substitution) may completely abolish function.5. The above sequences represent those of eukaryotes as the intron or the non-coding region (codons from 24 to 66, including 66) had to be removed before translating it into a polypeptide or a protein.

Whether sequence is eukaryotic or prokaryotic, it can be identified by the presence of introns and exons. In the case of prokaryotes, the initial RNA molecule or initial transcript is equivalent to the final mature RNA. In most eukaryotic genes, the initial transcript is processed so that the mature RNA is different. Most eukaryotes have genes that contain introns that do not code for polypeptides. However, prokaryotic genes do not contain introns. Eukaryotic RNAs, after transcription, have the intron sequences that are removed/ spliced in order to produce the final mature RNA.

The sequences in eukaryotes that are represented in the final RNA and code for amino acids in a polypeptide are called exons.6. The tRNA anticodon sequence that would build this protein is complementary to the mRNA sequence. The tRNA anticodon bonds to a given mRNA codon, by hydrogen bonding between A-U pairs and C-G pairs.The tRNA anticodon sequence to the mRNA sequence, UCUUCCCUCCUAAACGUUCAACC is: AGAAGGGAGGATTTGCAAGTTGGThe tRNA anticodon sequence to the mRNA sequence, UCAGACGUUUUUGCCCCGUAACACUCUUAACU is: AGTCTGCAAA AACGGGGCAT TGTGAGAATTGAThe tRNA anticodon sequence to the mRNA sequence, UACAAAAAGACCUCACAUGUAACAAAAAGAUAUGGG is: ATGTTTTTCTGGAGTGTACATTGTTTTTCTATACCC7.

The significance and function of the codons 24 to 66 (GGUUCUUAAUCCGCCGCCAGGGCCCCGCCCCUCAGAAGUUGGU)The above sequence represents the intron or the non-protein-coding region of the initial mRNA transcript. The intron sequences are spliced in order to produce the final mature RNA in eukaryotes. Introns play important roles in gene regulation. One of the functions of introns is that they regulate the frequency of transcription (messenger RNA synthesis) of the neighboring exons.8. In prokaryotes, starting with the amino acid sequence of protein, it is possible to obtain the same DNA nucleotide sequence as the encoding DNA does not contain introns.

However, in eukaryotes, it is not possible to obtain the same DNA nucleotide sequence as the encoding DNA is typically discontinuous: stretches of encoding DNA (called exons) are interspersed with long stretches of non-encoding DNA (called introns). After the DNA is transcribed into a string of RNA and before the RNA is translated into protein; the introns are edited/ spliced out.

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Assignment-Synthesis of a Protein Lab Report Example | Topics and Well Written Essays - 500 words”, n.d.)
Retrieved de https://studentshare.org/biology/1593973-assignment-synthesis-of-a-protein
(Assignment-Synthesis of a Protein Lab Report Example | Topics and Well Written Essays - 500 Words)
https://studentshare.org/biology/1593973-assignment-synthesis-of-a-protein.
“Assignment-Synthesis of a Protein Lab Report Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/biology/1593973-assignment-synthesis-of-a-protein.
  • Cited: 2 times

CHECK THESE SAMPLES OF Assignment-Synthesis of a Protein

Protein Synthesis

From the paper "protein Synthesis" it is clear that termination of polypeptide happens when the A site of the ribosome faces a stop codon (UAA, UAG or UGA).... hellip; Synthesis of protein takes place in Translation.... The process in which cells build up proteins is called protein synthesis.... Genes control the character of organisms through protein synthesis.... If there are errors in protein synthesis fitness of cells may be disrupted....
1 Pages (250 words) Assignment

Introduction to Biomedical Engineering

The most commonly used synthetic hydrogels are polymers of acrylic acid, acrylamide and 2-hydroxyethyl, ethacrylate.... The most biocompatible synthetic hydrogel is the poly (2- hydroxyethyl methacrylate).... t is commonly used for contact or intraocular lenses. When L-DOPA… Some of the effects caused on the human body by the L-DOPA include; reconstitution of the human skin....
3 Pages (750 words) Assignment

Biochemistry Discussion - Fats and Proteins

hellip; protein supplements are, therefore, necessary only for underweight people and lactating females because there are some non-essential amino acids that the body needs, but does not biosynthesize (protein, (n.... Biological processes are catalyzed by enzymes, which are protein in nature.... However, the RDA for protein “is calculated on an average person's ideal weight because protein is needed mainly for lean body tissue, not fat” (protein, n....
2 Pages (500 words) Assignment

Protein Synthesis Details

The paper “protein Synthesis Details” explains mechanisms of transcription, translation, replication during mitosis, mutation terms with descriptions how meiosis and prokaryotic reproduction differ, defines such terms as homozygous, heterozygous, homologs, autosomes, allele, genotype etc.... hellip; Just before the protein synthesis begins, an RNA molecule that corresponds to it is produced by transcription of RNA.... The ribosomes then move to the elongating phase of protein production....
3 Pages (750 words) Assignment

Relevant Arguments Regarding the Flocculation Technology

The paper "Relevant Arguments Regarding the Flocculation Technology" states that environmental engineering is an important engineering principle that utilizes science as well as the engineering mechanisms to solve the problem related to environmental degradation.... hellip; The settling time in the jar test is one of the most significant reasons behind the occurrence of the error and it arises because in most of the scenario of the flocculation process when the settling time often becomes too lengthy....
6 Pages (1500 words) Assignment

The Formation of the Earth

The last directly seen supernova was Kepler's star of 1604 (SN 1604).... Since the last directly observed supernova of 1604, it has been about five centuries an… From these observations, an occurrence of another supernova is long overdue. The theory based on extraterrestrial source proposes that the icy comets, meteoroids and other primordial objects rich in frozen water and water of Assignment, Astronomy Question Supernova occurrences in our galaxy are relatively rare, occurring about three times a century in the Milky Way....
2 Pages (500 words) Assignment

Microscopic Structure and Function of the Main Types of Human Cells

This new bone is termed osteoid, and it consists of bone collagen and other protein.... This assignment "Human Cells" outlines the microscopic structure and function of the main types of cells found in human bone and describes the process of mitosis and outlines how cell aging and death affect normal cell replication....
6 Pages (1500 words) Assignment

Oxidative Phosphorylation and the Electron Transport Chain

Since ADP is not present, hence it does not go through this antiporter (protein molecules that help to move two substrates in different directions) to form the new cycle of ATP.... This work called "Oxidative Phosphorylation and the Electron Transport Chain" focuses on a biochemical pathway in patient X....
10 Pages (2500 words) Assignment
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us