Nobody downloaded yet

Target career - Essay Example

Comments (0) Cite this document
Summary
I want to tell you about my target career which I aspire to achieve within the world of business. Nowadays business world is progressing day by day and high tech environment has helped…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER92.7% of users find it useful

Extract of sample "Target career"

Download file to see previous pages In my view no matter how well executed and implemented the strategies of the company are; it is actually money which guarantees a company’s success. With the ever increasing impact of advertising, one cannot deny the importance of numbers because at the end of the day a company has to make profits for the shareholders and survive. Further reasons of choosing accounting fields are:
An accountant is very important in every company or bank or government departments. Every project and every initiative taken by the company requires money. An accountant deals with the whole money handling procedures of a firm.
My target career is to work with the government to manage the countrys money inside and outside the country such us students scholarships and getting treatment abroad and employees truing courses. Working with government will give me more exposure to practical world. The responsibility of an accountant is very high because it is all about money which makes it not an easy job, but it seems interesting and fun with a high social position. The salary for the accountant in Qatar is about $10,000 to $15,000 a month, but if you have a Certified Public Accounting (CPA) your salary could be about $20,000 to $30,000 a month. In my view, this is a handsome salary package which I would want to pursue.
Since I am joining it also because of my personal strengths, I find it interesting to play with numbers and I really hope that it will be an interesting as well as a fruitful and learning experience for me and I am grateful to you for the guidance which you give ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Target career Essay Example | Topics and Well Written Essays - 250 words”, n.d.)
Target career Essay Example | Topics and Well Written Essays - 250 words. Retrieved from https://studentshare.org/miscellaneous/1599251-target-career
(Target Career Essay Example | Topics and Well Written Essays - 250 Words)
Target Career Essay Example | Topics and Well Written Essays - 250 Words. https://studentshare.org/miscellaneous/1599251-target-career.
“Target Career Essay Example | Topics and Well Written Essays - 250 Words”, n.d. https://studentshare.org/miscellaneous/1599251-target-career.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Target career

Target Corporation

...?Memorandum 05/02 Re: Target Corporation is the second largest discount retailer in the world and is centered in the Minneapolis, Minnesota area. From the downtown Minneapolis community, the company grew into the surrounding community, opening its first store in nearby Roseville in 1962. From those humble beginnings, nearly a half-century ago, Target has grown into a formidable presence in the discount retail market. With nearly $67 billion per year in revenue, over 355,000 employees, and 1,750 locations throughout the United States, it trails only Wal-Mart in terms of market share. Upon this foundation, Target is expanding its business operations internationally. It hopes to start retail...
8 Pages(2000 words)Research Paper

Target Corporation

...?Running Head: Target Corporation: Case Study Target Corporation: Case Study Table of Contents Executive Summary 3 Introduction 3 SWOT Analysis 5 Strengths  5 Weaknesses 6 Opportunities 6 Threats  7 Macro Environment Analysis 8 Economy  8 Culture  8 Politics  8 Technology  9 Conclusion 9 References 10 Executive Summary The following report is about analysis of Target Corporation. It starts with the introduction of company providing factors such as history, size, growth and revenue in detail. Introduction also includes Competition analysis of company, its success factors, Mission statement of the company and market analysis. Then the SWOT analysis of Target Corporation...
7 Pages(1750 words)Case Study

Target Costing

...?Target Costing s s April 18 Target Costing The aim of each and every business is to make profit once commenced. One factor that affects the profit margin of an enterprise is the concept of costs and many firms are fully aware of the concept. Target costing is a tool that is employed to assist in cost reduction in a particular undertaking once the maximum profit is determined hence the firm is capable of managing its costs. Cost reduction means that the profit margin shows positive progress. The essay will focus on how target costing improves profitability of an enterprise once implemented via assistance of expertise that have knowhow on how to handle the tool. One of the...
2 Pages(500 words)Article

Target

...? Target Corporation of the of Table of Contents Introduction 3 Possible solutions to the problem 4 Conclusion 8 References 11 Introduction The modern business world is highly competitive. The main business objective of firms is to gain higher profit and take the company to better levels of business performance. In the course of doing business companies study the strategies of their competitors and try to develop superior strategies. Any company that has an edge over its competitors offers greater value to its customers than the products offered by rivals by offering lower prices or higher quality at similar prices (Wagner, 2005). Product quality plays an important role in determination of performance of companies that...
9 Pages(2250 words)Research Paper

Target plc

...?Contents Introduction 2 Financial Highlight 3 Corporate Strategy 3 Competitive Analysis 4 Competitive Advantage 4 SWOT Analysis 5 Financial Analysis7 Profitability Ratios 7 Liquidity and efficiency ratios 9 Structure Ratios 11 Conclusion 13 References 15 Introduction Target plc is one of the largest companies based in America providing food ingredients and retail and grocery solution worldwide. The study provides the details financial analysis of the company. In the case study the financial and operational evaluation of the company in questions has been undertaken. For the purpose of operational capability of the company, its corporate strategy has been analyzed in addition to the competitive environment and other risks... to which it is...
11 Pages(2750 words)Assignment

Target Markets

...be said to have been correctly targeted by the advertising campaign, and Kelly represents an instance when an experience of others instigates us to repeat it. After awareness, the next crucial step in buyers decision process is the emergence of the interest in a product or service. Surely, if this step does not occur, then buyers awareness would be useless for sellers. And of course, the real interest can emerge not just after the brief attention to catchy ads, but if the message persuades people that a product or service suits their needs. In our case, the attempt was made to reflect this stage of the decision-making process by the question about why did Greg and Kelly assume that the phone would satisfy their needs. In...
4 Pages(1000 words)Essay

Target Company

.... Target employs excellent managers and experts I would like to work with. This function is concerned with dividing work and allocating it among employees and determining their responsibilities and relations. At Target, all employees come from different cultural and social environment; they have different social statuses and class location, different religious beliefs and belong to different cultures. These differences create a certain tension between employees which requires special intervention actions of organizing activities to manage workforce diversity (www.target.com). Target should hire me because I am a professional in my field, career-oriented person and have...
3 Pages(750 words)Case Study

Target Prediction

..., or coordinates, for “mmu-mir-223”? Answer = “mmu-mir-223” can be genetically mapped to ChrX:93438156-93438265 bp, + strand Question 1.f What is the “Stem-loop” sequence for “mmu-mir-223”? Answer = The “Stem-loop” sequence for “mmu-mir-223” is: UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG Question 1.g What is the “Mature” sequence for “mmu-mir-223”? Answer = The “Mature” sequence for “mmu-mir-223” is: >mmu-miR-223-3p MIMAT0000665 UGUCAGUUUGUCAAAUACCCCA >mmu-miR-223-5p MIMAT0017056 CGUGUAUUUGACAAGCUGAGUUG Question 2.a Using TargetScanHuman (http://www.targetscan.org/vert_50/), species set to “Mouse”, and all other search criteria kept at default settings, how many...
2 Pages(500 words)Essay

College and career readiness ( my target group is high school students)

...that have colored children as the majority still receive minimal funding. This leaves to conclude that it would have been better were the schools to remain segregated, but having similar education amenities (p.4). She goes on to say that in terms of graduating from college, the percentage of color students graduating is two to three percent of the graduating population. This is a subtle fraction of the graduates; this leads to concluding that although measures have been put to place to enhance desegregation, it is not practically working (Zirkel, 2004, p.5). How My Leaning Will Impact or Influence My Professional Practice The case of Brown Vs Board of Education of Topeka on Education will be very beneficial and will influence my...
4 Pages(1000 words)Assignment

The Target

...THE TARGET Creative Personal Essay The poem, The Target, explains about a person who was in the firing squad in an event of war. This person had to shot a boy in self-defense. If he failed to shoot him, he would be the one shot by that boy and might have led to his death. The soldiers’ mother could not find any sleep, as she had no peace fearing that his son might be shot in the war and die. The soldier even goes ahead and wishes that it was better that he dies as this will ease the fears in his/ mother. After shooting that boy, thoughts about his actions start hitting his mind. He/she starts thinking what if that boy was the only son in his family. The soldier thinks what this boy’s parents would go...
5 Pages(1250 words)Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Essay on topic Target career for FREE!

Contact Us