StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

The Uniform Crime Reports (UCR) - Assignment Example

Cite this document
Summary
The purpose of UCR (Uniform Crime Reporting) is the production of crime statistics that are reliable for the administration, management as ell as operation of law enforcement. Uniform Crime Reporting information is also used as a way of measuring the changes in the volume and…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER92.7% of users find it useful
The Uniform Crime Reports (UCR)
Read Text Preview

Extract of sample "The Uniform Crime Reports (UCR)"

The Uniform Crime Reports (UCR) Number What is the purpose of the Uniform Crime Reports?  The purpose of UCR (Uniform Crime Reporting) is the production of crime statistics that are reliable for the administration, management as ell as operation of law enforcement. Uniform Crime Reporting information is also used as a way of measuring the changes in the volume and type of crime in a given area. To achieve this objectives or purpose, different ways are used. First, it is through measuring the fluctuation, distribution, nature and extent of the crime by collecting data about the eight major crime index offenses.

Second, is by measuring the volume of the serious crime or crimes that are known to the police officers. Finally, it is done by showing the coverage and activity of agencies that are responsible for law enforcement through counting the number of arrests and using the strength data of police employee (Siegel, 2009).2. Where does the FBI obtain the data for the UCR? In Uniform Crime data reporting, reports for crimes are obtained from agencies responsible for law enforcement via the nation based on reporting procedures and uniform classifications.

In order to provide the most complete outlook of crime in the U.S data is obtained only on offenses that are usually known by police officers. A meaningful view of crime can be seen by examining the seven major Crime Index offenses. These are chosen for their seriousness, likelihood of a report being made and the frequency of occurrence: forcible rape, murder, robbery, burglary, aggravated assault, motor vehicle theft and larceny-theft. The FBA can get the number of crime offenses from reports of law enforcement agencies.

The law enforcement agencies have records of victim complaints, witness reports and crime reports discovered during operations of the agency. The reports can be obtained from the contributing law enforcement agencies on a monthly basis. To ensure that there is uniformity and that quality of the data is maintained for any received data, Uniform Crime Reporting should ensure provision of training on all detailed procedures used for classifying and scoring offenses (Leonard, 2001).3. Why do you think a member of the examined population might choose to not submit information for the UCR?

Since it was started, the uniform Crime Reporting plan has been able to provide a reliable, steady flow of information concerning crime in the country. However, since Uniform Crime Reporting is a summary reporting system, people may not provide data concerning individual crime incidences. The summary based method, even though it is reliable, has limitations in various aspects which can hinder submission of information from the examined population. These include lack of sufficient information regarding various offenses, arrests made and offender/victim relationships.4. Do you think the UCR would be an accurate tool to compare the efficiency of two different police departments?

The main concern in collection of crime information is the uniformity and validity of received data. With reports being received from more than nine hundred and fifty jurisdictions, the concern of achieving uniformity is readily clear. Every report that comes in is checked for reasonableness and accuracy by the use of several crosschecking procedures. Whereas minor errors may be corrected by the uniform crime reporting verifiers, there may be unusual variations that attract the attention of the submission agency through direct contact of the Uniform Crime Reporting field representative (FBI, 1966).

ReferencesSiegel, L.J. (2009). Introduction to Criminal Justice. Cengage Learning. Leonard, B. (2001). Crime in the United States (1999): Uniform Crime Reports. DIANE Publishing. Uniform crime reporting handbook: how to prepare Uniform crime reports. (1966). Washington, D.C.: Federal Bureau of Investigation, U.S. Dept. of Justice.

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“The Uniform Crime Reports (UCR) Assignment Example | Topics and Well Written Essays - 500 words”, n.d.)
Retrieved from https://studentshare.org/law/1613893-the-uniform-crime-reports-ucr
(The Uniform Crime Reports (UCR) Assignment Example | Topics and Well Written Essays - 500 Words)
https://studentshare.org/law/1613893-the-uniform-crime-reports-ucr.
“The Uniform Crime Reports (UCR) Assignment Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/law/1613893-the-uniform-crime-reports-ucr.
  • Cited: 0 times

CHECK THESE SAMPLES OF The Uniform Crime Reports (UCR)

Classical and Positivist Views on Crime

The writings of Beccaria dwelt on the form of punishment befitting the crime and not any harsher.... However, crime statistics which began to be observed annually in France from 1827 showed that there was no salutary effect of the newfound theory.... If anything, statistics revealed that crime rates were going up, not moving down.... Thus, other factors were felt necessary to bring down the crime rate.... Positivist criminology, unlike its classical counterpart, was more environmental and less biological in its outlook and approach to the study, observation and application of the causes and effect of justice and crime....
4 Pages (1000 words) Book Report/Review

Crime and Punishment by Fyodor Dostoyevsky

  This report "crime and Punishment by Fyodor Dostoyevsky" discusses the philosophical implications of the book are great and the story shows how a totally wrecked individual finds his mooring in life and tries to reform and rehabilitate.... Once the crime is committed, a series of thought-currents related to the incidents begin to tax the brains of the perpetrator of the crime....
11 Pages (2750 words) Book Report/Review

Discussion board Common Crimes and Consequences

What are some differences and similarities between deviance and crime?... The difference between deviance and crime is the legality of the act.... The similarity between deviance and crime are both type of behaviors are violations of the norm.... What are some differences and similarities between deviance and crime?... The difference between deviance and crime is the legality of the act.... The similarity between deviance and crime are both type of behaviors are violations of the norm....
1 Pages (250 words) Book Report/Review

Crime as a Major Social Vice in any Society

Increasing crime rate in a society is a sign of ineffective policies that govern crime mitigation.... In his book, Michael Tonry discusses the nature of crime mitigation policies in the United States.... He observes that the mechanisms… The American political elite continue to grapple with the dynamic trends in crime.... Tonry explains that a growing population of prisoners in the country does not actually imply an increasing crime rate in the society....
7 Pages (1750 words) Book Report/Review

Writing a protocol for genomic DNA extraction and PCR

10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda DNA (0.... μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,… The genomic DNA (DNA fast, Qiagen , cat , no , 51204) as isolated from the tumoral tissues adjacent to the non-tumoral tissues blood collection for control experiment was equally undertaken for the purpose with regards to the manufactures protocol ....
4 Pages (1000 words) Lab Report

Computer Crimes and their Avoidance

acking is a very common computer crime, in which hackers control computer systems in a network and operate them for their own illegal purposes.... hishing is a computer crime, in which the offender steals the identity of online computer users.... This report "Computer Crimes and their Avoidance" presents the internet that has engendered a virtual world, where distances are no longer of any significance....
7 Pages (1750 words) Report

DNA Extraction and PCR of Bird DNA for Sex Identification

The "DNA Extraction and PCR of Bird DNA for Sex Identification" paper aims to extract the DNA from the muscle, blood, and feather of Gallus gallus and to estimate the concentration of the DNA from the three samples and amplify the CHD1 gene using PCR.... hellip; DNA is the basic component of genes....
9 Pages (2250 words) Lab Report

Crime Reduction in the USA

This book review "crime Reduction in the USA" focuses on the reasons for the reduction in crime based on 'The City That Became Safe: NY's Lessons for Urban crime and its Control'.... The paper will also analyze the possibilities that may exist to ensure crime reduces in a significant amount.... hellip; Most US states experienced a rapid rise in crime during the twentieth century.... 'The City That Became Safe: NY's Lessons for Urban crime and its Control' illustrates well how crime reduction was achieved during the 1990s....
7 Pages (1750 words) Book Report/Review
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us