Molecular Biology Techniques - Assignment Example

Molecular Biology Techniques by of College Question Refer to the following map of a common DNA cloning vector. What is the functional importance of each of the following components? (2 marks each) a) lac Z : is a gene whose product, beta galactosidase, cleaves colorless X-gal to a blue colored product. If the transformation is successful, white colonies are produced due to insertion of gene of interest within the gene of lac Z thereby disrupting it. If transformation is not successful, blue colonies are produced. b) Ampr : ampicillin resistance gene is a selectable marker. A selectable marker gene is to provide the host containing the plasmid a certain property that is not inherently present in the host. For example, the Ampr gene codes for a protein that makes cells containing this gene resistant to the antibiotic ampicillin. So when plasmid is successfully transfected into a host cell, the host cell will become resistant to ampicillin and will grow in the media containing the antibiotic. c) T3 and T7: are T3 and T7 RNA polymerase promoters for in vitro production of RNA. These two promoters are present on the opposite strands in the cloning sites. Hence the inserted DNA can be synthesized from either strand, increasing the productivity of the protein. d) f1 (+) origin : It is an origin for replication of DNA for the production of single stranded DNA. Each strand can then be transcribed into mRNA for translation. e) MCS : multiple cloning site: this stretch of the vector DNA contains many restriction sites introduced artificially. These restriction sites can be cleaved by different restriction enzymes and the gene of interest can be inserted between the stick ends generated. Question 2 (2 marks each) Forensic evidence prepared by multi-locus DNA profiles of blood traces from a crime scene and blood samples of seven suspects, is shown below (left). This evidence is presented as an autoradiograph of Southern-blotted restriction-digested DNA, which had been probed with a multi-locus repeated DNA sequence. A similar case analysed by PCR amplification of a single-locus DNA (below right), shows evidence from several individuals and allelic ladders. a) Based on the multi-locus evidence (left) which suspect is likely to be guilty? Suspect # 3 is most likely to be guilty of crime. b) There are problems with the multi-locus test method. Describe one main problem. One of the problems with multi-locus test method is that if the sample is degraded, the fragments due to degradation may add new false lines to the fingerprints, which may not be due to restriction sites. These may give false negative report. c) How do you account for there being 2 bands in each lane of the single-locus analysis (right)? Two bands come from the alleles (2n number of chromosomes in somatic cells). Due to recombination or replication errors, alleles with different numbers of repeat arise and always show two separate bands. d) Multi-locus DNA fingerprinting is based on the detection of RFLPs. Single-locus DNA fingerprinting is based on the detection of which DNA element? Single-locus DNA fingerprinting is based on the detection of STR, short tandem repeats, microsatellites. e) What is the major advantage of using single-locus tests over multi-locus tests in criminal cases and in the identification of human remains? Single-locus tests works well with low amounts (nanograms) of undegraded DNA as compared to multi-locus DNA tests (where micrograms of undegraded DNA is required). Page 3 of 10 Question 3 The following diagram shows temperatures during DNA amplification by PCR. Temperature 100o -- 1 3 2 0o Time a) Describe what is occurring at the three main steps (1,2 & 3 above) in each cycle of amplification by PCR. Step 1. This step occurs around 94-98 deg cel. DNA melting occurs at this temperature. High temperature breaks the H-bonding between complementary base pairs and converts a double stranded DNA into single stranded DNA. Step2. This step occurs at 50-65 deg cel. It is called annealing. It allows primers to anneal or complementary base-pair with the single stranded DNA. This double stranded region is necessary for the DNA polymerase to bind and begin DNA synthesis. Step3. This step occurs around 72 deg cel. DNA extension occurs at this temperature. DNA polymerase begins to synthesize a new DNA strand complementary to the template. (3 marks) b) Name 4 important components of a PCR reaction (apart from buffer and water)? DNA template Two primers Taq polymerase Deoxynucleoside triphosphates dNTPs (2 marks) c) Using the standard formula, calculate the approximate melting temperature of this PCR primer: 5-GAATTGGCACCCTAGCGAACG-3. For sequences longer than 13 nucleotides, the equation used is      Tm= 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC), where w,x,y,z are the number of the bases A,T,G,C in the sequence, respectively. So Tm= 56.3 deg cel (3 marks) d) Briefly explain how primers can be used in PCR to produce site-directed mutagenesis (i.e. changing a DNA sequence). 1. Normal PCR: In this technique the primers are designed to include the desired change, which could be substitution, addition or deletion of a base in the primer. Hence during PCR the mutation is introduced into the amplicon by replacing the original sequence. 2. Primer Extension: This technique requires independent and nested primers. The reaction requires flanking primers (say A and D) complementary to the ends of the target sequence, and two internal primers with complementary ends (say B and C) which contain the desired mutation and will hybridize to the region to be altered. During the first round of PCR, the AB and CD fragments are created. These products are mixed for the second round of PCR using primers A and D. The complementary ends of the products hybridize in this second PCR to create the final product, AD, which contains the mutated internal sequence. 3. Inverse PCR: Inverse PCR enables amplification of a region of unknown sequence using primers oriented in the reverse direction. (2 marks) Question 4 Cloning (2 marks each) You want to clone a PCR product into a plasmid*, briefly describe how you would: a) Purify the PCR product Run the PCR products in an agarose gel. Cut off the pieces of the gel containing your product. Then solubilize the gel to release the DNA. Then load the sample onto a spin-column and isolate PCR product by using bind, wash and elute process. The DNA is recovered using TE buffer or water, ready for next step. b) Prepare the plasmid For plasmid preparation restriction endonucleases leading 4 base 5’-overhangs, that are complementary to digested PCR product 5’-overhangs should be used. If PCR fragment after digestion has different 5’-overhangs, the vector should be digested with two different restriction endonucleases, resulting in 4 base 5’-overhangs, complementary to PCR fragment sticky ends. After the digestion plasmid should be dephosphorylated using alkaline dephosphatases. c) Ligate the insert into the vector Determine the approximate concentration of the plasmid from the agarose gel. Determine the amount of PCR fragment DNA equivalent to desired moles of ends. The plasmid: PCR product ratio should be 1:3. Use DNA ligase in a microcentrifuge tube to ligate the plasmid and the DNA inserts. d) Transform the recipient cells Incubate a single colony of the cells to be transformed in Luria broth and let them grow upto 10 8 cells / ml. Centrifuge the cells and resuspend the pellet in ice cold 0.1 M CaCl2 to make the competent cells. Add the plasmid to these cells and incubate exactly for 90 seconds and return to ice bath for 1-2 minutes. Spread the cells onto a plate containing X-gal and Kanamycin and incubate at 37 deg cel overnight. e) Select on appropriate selective media for plasmids containing inserts. The media should contain X-gal, an activator called IPTG (isopropyl-[beta]-D-thiogalactopyranoside and kanamycin antibiotic in it. *The plasmid available to you for cloning is optimized for cloning PCR products, allows for blue-white screening and contains the KanR gene. Question 5 DNA and medicine a) Describe two techniques for identifying a mutation in a patient with a genetic disorder, and in each case give an example of a genetic disease for which this type of mutation detection is used. (3 marks) 1. Single Strand Conformational Polymorphism: This method can detect single base pair mutations like frameshift mutations, nonsense mutations and missense mutations. The basic principle of this test is that double stranded DNA when denatured, assumes a special conformation. This conformation is unique and depends on primary nucleotide sequence. The difference in shape between two single-stranded DNA strands with different sequences can cause them to migrate differently on an electrophoresis gel, even though the number of nucleotides is the same It is used to detect breast cancer gene BRCA1 and BRCA 2. 2. DNA microarray: In this method, a large number of DNA fragments are placed on a glass slide. The fragments are allowed to complement or bind with the labeled DNA (probes), which hybridize with the DNA on the glass slide. The amount of hybridization is then analyzed in each spot on the slide. The genes are given a color where the hybridized ones are colored red and the genes that are hybridized least are colored green. Based upon the colors generated, the computers detect mutation. It is used highly for hemophilia A. b) Name two types of DNA-based therapies. (1 mark) 1. Gene therapy. 2. Oligonucleotide therapy For one of these types of DNA-based therapies chosen in (b) above, provide the following information: c) Principles and mechanism of action (2 marks) Principle: Introduction of genetic material into cells using viruses to compensate for abnormal genes or to make a beneficial protein. Mechanism: the introduced gene transcribes into a normal or correct protein, so that normal cellular functions are resumed. This is achieved by introduction of a normal gene, swapping abnormal gene with normal gene by homologous recombination, repairing abnormal gene by selective reverse mutation or by altering gene regulation. d) Advantages and disadvantages (2 marks) Advantages: Genetically inherited diseases like cystic fibrosis, muscular dystrophy or thalassemia can be cured. It can be used to cure cancer, which occurs later in the life. It can be focused to a specific cell type to possibly avoid systemic toxic effect. Disadvantages: Introduced gene may be short lived or not replicating long enough, hence patient may need to undergo multiple rounds of therapy. The recipient may react immunological to reject the inserted gene or its vector. Screening of embryos or fetus for genetic disorders may have legal and ethical issues. Multi-gene disorders may not be corrected, unlike single gene disorders. It is an expensive therapy and only the rich can afford it. e) Disease(s) for which this form of treatment has been attempted/trialled. (2 marks) Leukemia Hemophilia SCID, severe combined immunodeficiency Leber congenital amaurosis, a rare blindness disease Page 6 of 10 Question 6 Expression a) Name two uses for fusion proteins. (2 marks) 1. Fusion proteins can be used for analysis of protein-protein interaction regions. 2. Fusion proteins can be used to visualize cellular organelles when tagged with a green fluorescent protein. b) What are the three essential requirements for fusion protein expression in E. coli? (3 marks) The plasmid/vector should have 1. transcriptional promoter 2. a ribosome binding site 3. an origin of replication c) Briefly explain the role of promoters in protein expression. (3 marks) Promoters are regions on DNA, located just prior to the gene to be transcribed. RNA polymerase, the enzyme for transcription, and the transcription factors that regulate the transcription, binds to the promoter to initiate transcription. They usually consist of TATA sequences and are found -10 and -35, upstream of the initiation site. d) Give one example of how fusion proteins can be purified. (2 marks) A GST (glutathione S transferase) fusion protein can be separated as follows: Prepare glutathione-sepharose beads by first washing the 50% bead slurry with PBS. Then the cells (with fusion proteins) are lysed by treating the cell pellet with lysozyme in presence of protease inhibitor cocktail and sonicating in short bursts until cells disrupt. Solubilize the released proteins in triton –X. Spin and collect the supernatant. Pour the supernatant over the glutathione-sepharose bead column. Wash away unbound protein. Then elute out bound protein (of interest) by glutathione elution buffer. Estimate using Bradford method. Question 7 You have cloned the cDNA for an unknown gene into the EcoRI site of pBluescript (MCS shown below). a) Name two sequences that you could use as primers for ‘dideoxy’ chain termination sequencing of your cDNA insert from each of its two ends (2 marks) 5’CATTTTGCTGCCGGTC3” AND 5’AGTACCAGTATCGACAAAGG3’ b) Once you have the sequence, which web-site would you visit to possibly identify your cDNA? (give the full name, or its acronymn) (1 mark) < http://www.ncbi.nlm.nih.gov/pubmed/>. National Center for Biotechnology Information. c) At that web-site, what particular kind of search would you perform with your nucleotide sequence, if you were interested in seeing if the product of your gene was closely related to any other known protein/s? Name a tool and a database and explain how you would interpret the results (3 marks) The BLAST will be used, specifically; Nucleotide query- protein database [blastx] will be used. The results are interpreted based on the colors of the graph presented. The bar color for a hit refers to alignment score, a mathematically derived value that reflects the degree of similarity between hit and query sequences. The higher the score, the more similar the two. The Color Key at the top of the graphical display gives the range of alignment scores assigned to each color. For example, red hits are most similar, with alignment scores greater than or equal to 200, while black hits are least similar, with alignment scores lower than 40. d) Briefly describe two other analyses of your gene product that you could perform at this web-site or any other that would predict functional properties (for example, the cellular location) of the predicted protein. 1. PredictProtein. This site predicts the protein functions like if it binds to DNA, has metal binding site, or is transmembrane protein etc. 2. STRING. This is a tool to predict the interaction between genes and proteins. The predictions are based on genomic contexts. Page 8 of 10 Question 8 DNA Libraries Genomic and cDNA libraries are used for different purposes. a) State when you would chose to make a genomic library or a cDNA library (assume you are working with Eukaryotic cells). (4 marks) cDNA library is made when complete genome of an organism is to studied to make transgenic organism. When regulatory elements like promoters and enhancers are to be studied, genomic library is made, because they include such elements and are not found in cDNA library. To study the introns and exons within a gene, genomic library is made. When the protein product of a gene is to be studied, cDNA library is made. b) Give two types vectors for cloning large pieces of DNA in a genomic library. 1. YAC, yeast artificial chromosome 2. BAC, bacterial artificial chromosome. (2 marks) c) Give one example of information you can only determine using cDNA libraries. cDNA libraries can give information only about the coding region of the genome, it does not contain any information about the non-coding region. (2 marks) d) Give two reasons why antibody screening a cDNA expression library is useful. Antibody screening is useful because: 1. Antibodies permit simultaneous screening of a panel of analyte. 2. They are more rapid and sensitive than conventional screening methods. (2 marks) Page 9 of 10 Question 9 Probes and Detection a) Name 4 techniques in molecular biology that use probes. (4 marks) 1. RT-PCR 2. DNA Microarray 3. Southern hybridization 4. Restriction fragment length polymorphism, or RFLP b) List two factors to consider that will affect hybridization of probes. (2marks) 1. Probe accessibility to the target and, 2. Affinity of the probe to the targeted molecules c) If you are planning to run a southern blot, suggest two ways you could label the probe. (2 marks) 1. PCR labeling: This is an easy method of probe incorporation. Design primers that will amplify a sequence you wish to use as a probe, and simply include a labeled dNTP during PCR. 2. Nick translation involves the action of 2 enzymes on the dsDNA you wish to label: DNase I and DNA polymerase I. Under conditions designed to limit its activity, DNase I will randomly introduce a few nicks (i.e. single strand breaks) in the DNA backbone. These nicks are repaired by DNA polymerase I. DNA polymerase synthesizes DNA in a 5’-3’ direction. It also has an exonuclease activity. These two activities act together to remove and then replace a few nucleotides down from each nick. The newly formed sequence bits are now labeled. d) Describe how you can ensure high stringency during the hybridization step. (2 marks) High stringency during the hybridization step can be achieved by using high hybridization temperature and low salt in hybridization buffers. Tm of 25 deg cel for DNA probes, and about 1.5 m of Na+ is recommended for higher stringency. Page 10 of 10 Question 10 The following diagram shows the general features of human mitochondrial DNA. a) List 4 main structural features of human mtDNA (Don’t just name the genes). 1. It is a covalently closed circular double stranded genome. 2. It consists of 16 569 bp only. 3. Introns are absent in mtDNA, and all of the coding sequences are contiguous. 4. mtDNA has two strands, a guanine-rich heavy (H) strand and a cytosine-rich light (L) strand. (4 marks) b) Comment on the mode of inheritance of mtDNA in mammals. (2 marks) mtDNA is maternally inherited. The mammalian egg contains about 100,000 molecules of mtDNA, while the sperm contains of the order of 100–1500 mtDNAs. Sperm mitochondria enter the egg during fertilization but they appear to be lost early in embryogenesis, soon after fertilization, between the two-cell and four-cell stages c) The same primer set has been used to amplify a 307 bp region of the cytochrome oxidase b gene in many different vertebrates. What does this imply about the sequence to which the primers hybridise? (2 marks) This implies that the sequence to which the primers hybridize is same or almost same in all vertebrates and has been conserved throughout evolution. The gene for cytochrome oxidase b has evolved very slowly, so much so that it can be used for species identification d) You wish to amplify a section of mtDNA from an ancient frog bone. In designing your PCR primers, describe one precaution you would make to ensure that you would not amplify your own (contaminating) mtDNA. (2 marks) In this case the primes should be designed from the hypervariable regions of the mtDNA of the frog, for example the D-loop. Since these regions have mutated over the years, it would be unlikely that the primers designed against this region of the ancient frog will hybridize to modern man’s mtDNA. Read More