Target Prediction - Essay Example

UMUC BIOT630 Lecture 10 Exercise – “Due Version” Question a Using miRBase (http www.mirbase.org), what is the accession number for “mmu-mir-223”?Answer = The accession number for “mmu-mir-223” is MI0000703.Question 1.bOverlooking the record provided as your answer to Question 1.a, what “Gene Family” does “mmu-mir-223” belong to?Answer = “mmu-mir-223” belongs to MIPF0000067; mir-223 (23 sequences) gene family.Question 1.

cWhat gene does “mmu-mir-223” fall within?Answer = The “mmu-mir-223” is an RNA gene” or a “non-coding RNA gene (ncRNA) involved in gene regulation.Question 1.dWhat type of gene feature does “mmu-mir-223” fall in? Answer = “mmu-mir-223” is a microRNA (miRNA) gene.Question 1.eWhat is the genomic position, or coordinates, for “mmu-mir-223”? Answer = “mmu-mir-223” can be genetically mapped to ChrX:93438156-93438265 bp, + strand Question 1.

fWhat is the “Stem-loop” sequence for “mmu-mir-223”?Answer = The “Stem-loop” sequence for “mmu-mir-223” is:UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAGQuestion 1.gWhat is the “Mature” sequence for “mmu-mir-223”?Answer = The “Mature” sequence for “mmu-mir-223” is:>mmu-miR-223-3p MIMAT0000665UGUCAGUUUGUCAAAUACCCCA>mmu-miR-223-5p MIMAT0017056CGUGUAUUUGACAAGCUGAGUUGQuestion 2.

aUsing TargetScanHuman (http://www.targetscan.org/vert_50/), species set to “Mouse”, and all other search criteria kept at default settings, how many “conserved targets”, “conserved sites”, and “poorly conserved sites” are there for “mmu-miR-223”? Answer = There are 150 conserved targets, with a total of 154 conserved sites and 43 poorly conserved sites for “mmu-miR-223”.Question 2.bIn the target list exists “F3”.

What sites does “mir-223” bind in the 3’ UTR for this mRNA? To answer, click on the corresponding “Site in UTR” link. Then, copy paste screen shot. The sites will be designated as outlined boxes.Answer = Question 2.cOf the total number of “miR-223” binding sites that occur in the “F3” 3’ UTR (see you’re your answer to Question 2.b), how many are “Conserved”?Answer = Of the total number of “miR-223” binding sites that occur in the “F3” 3’ UTR, only one is conserved.

Question 2.dOf the “Conserved” “miR-223” binding sites in the “F3” 3’ UTR, what appears to be the consensus sequence in the miRNA that binds the mRNA target sequence?Answer = Of the “Conserved” “miR-223” binding sites in the “F3” 3’ UTR, the consensus sequence in the miRNA that binds the mRNA target sequence is AACUGAC.Question 3.aUsing your answer to Question 1.f in conjunction with Mfold (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form), what is the secondary structure prediction?

To answer, keep all parameter settings set to default, scroll down to bottom of form and click on “Fold RNA”. After, open/copy/paste the “Vienna” formatted prediction for Structure 1.Answer = Structure 1: Folding bases 1 to 110 of mmu-mir-223 stem-loop sequence Initial ΔG = -44.50The “Vienna” formatted prediction for Structure 1 is as follows:UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAGQuestion 3.

bWhat does the 2D rendering for the Structure 1 prediction look like? To answer, open/copy/paste the “pdf” or “png” formatted prediction for Structure 1.Answer = The 2D rendering for the Structure 1 prediction looks as shown below.Question 4.aGiven the following RNA “Stem-Loop” sequence:>What am I?CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCAWhat miRNA family does the miRBase “Search” feature (http://www.mirbase.org/search.shtml) say it is likely a member of?

To answer, review the search results, explore the recorded family entries in the corresponding records, report the consensus entry as your answer.Answer = Upon search against miRNA sequences, the miRNA’s are a member of “MIPF0000014; mir-9” miRNA family. The consensus sequence is: ucuuugguuaucuagcuguaugaQuestion 4.bUsing the same RNA “Stem-Loop” sequence in Question 4.a, what miRNA family does the Rfam “Search” feature (http://rfam.sanger.ac.uk/search) say it is likely a member of?

Answer = the miRNA’s are a member of mir-9/mir-79 (RF00237) microRNA precursor family.Question 4.cPer your answers to Questions 4.a and 4.b, would you say Rfam and miRBase provide similar or different results? Answer = Definitely, both of them produce the same results.