StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Target Prediction - Essay Example

Cite this document
Summary
Using TargetScanHuman (http://www.targetscan.org/vert_50/), species set to “Mouse”, and all other search criteria kept at default settings, how many “conserved targets”, “conserved sites”, and “poorly conserved sites” are there for “mmu-miR-223”? In the…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER94.1% of users find it useful
Target Prediction
Read Text Preview

Extract of sample "Target Prediction"

UMUC BIOT630 Lecture 10 Exercise – “Due Version” Question a Using miRBase (http www.mirbase.org), what is the accession number for “mmu-mir-223”?Answer = The accession number for “mmu-mir-223” is MI0000703.Question 1.bOverlooking the record provided as your answer to Question 1.a, what “Gene Family” does “mmu-mir-223” belong to?Answer = “mmu-mir-223” belongs to MIPF0000067; mir-223 (23 sequences) gene family.Question 1.

cWhat gene does “mmu-mir-223” fall within?Answer = The “mmu-mir-223” is an RNA gene” or a “non-coding RNA gene (ncRNA) involved in gene regulation.Question 1.dWhat type of gene feature does “mmu-mir-223” fall in? Answer = “mmu-mir-223” is a microRNA (miRNA) gene.Question 1.eWhat is the genomic position, or coordinates, for “mmu-mir-223”? Answer = “mmu-mir-223” can be genetically mapped to ChrX:93438156-93438265 bp, + strand Question 1.

fWhat is the “Stem-loop” sequence for “mmu-mir-223”?Answer = The “Stem-loop” sequence for “mmu-mir-223” is:UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAGQuestion 1.gWhat is the “Mature” sequence for “mmu-mir-223”?Answer = The “Mature” sequence for “mmu-mir-223” is:>mmu-miR-223-3p MIMAT0000665UGUCAGUUUGUCAAAUACCCCA>mmu-miR-223-5p MIMAT0017056CGUGUAUUUGACAAGCUGAGUUGQuestion 2.

aUsing TargetScanHuman (http://www.targetscan.org/vert_50/), species set to “Mouse”, and all other search criteria kept at default settings, how many “conserved targets”, “conserved sites”, and “poorly conserved sites” are there for “mmu-miR-223”? Answer = There are 150 conserved targets, with a total of 154 conserved sites and 43 poorly conserved sites for “mmu-miR-223”.Question 2.bIn the target list exists “F3”.

What sites does “mir-223” bind in the 3’ UTR for this mRNA? To answer, click on the corresponding “Site in UTR” link. Then, copy paste screen shot. The sites will be designated as outlined boxes.Answer = Question 2.cOf the total number of “miR-223” binding sites that occur in the “F3” 3’ UTR (see you’re your answer to Question 2.b), how many are “Conserved”?Answer = Of the total number of “miR-223” binding sites that occur in the “F3” 3’ UTR, only one is conserved.

Question 2.dOf the “Conserved” “miR-223” binding sites in the “F3” 3’ UTR, what appears to be the consensus sequence in the miRNA that binds the mRNA target sequence?Answer = Of the “Conserved” “miR-223” binding sites in the “F3” 3’ UTR, the consensus sequence in the miRNA that binds the mRNA target sequence is AACUGAC.Question 3.aUsing your answer to Question 1.f in conjunction with Mfold (http://mfold.rna.albany.edu/?q=mfold/RNA-Folding-Form), what is the secondary structure prediction?

To answer, keep all parameter settings set to default, scroll down to bottom of form and click on “Fold RNA”. After, open/copy/paste the “Vienna” formatted prediction for Structure 1.Answer = Structure 1: Folding bases 1 to 110 of mmu-mir-223 stem-loop sequence Initial ΔG = -44.50The “Vienna” formatted prediction for Structure 1 is as follows:UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAGQuestion 3.

bWhat does the 2D rendering for the Structure 1 prediction look like? To answer, open/copy/paste the “pdf” or “png” formatted prediction for Structure 1.Answer = The 2D rendering for the Structure 1 prediction looks as shown below.Question 4.aGiven the following RNA “Stem-Loop” sequence:>What am I?CGGGGUUGGUUGUUAUCUUUGGUUAUCUAGCUGUAUGAGUGGUGUGGAGUCUUCAUAAAGCUAGAUAACCGAAAGUAAAAAUAACCCCAWhat miRNA family does the miRBase “Search” feature (http://www.mirbase.org/search.shtml) say it is likely a member of?

To answer, review the search results, explore the recorded family entries in the corresponding records, report the consensus entry as your answer.Answer = Upon search against miRNA sequences, the miRNA’s are a member of “MIPF0000014; mir-9” miRNA family. The consensus sequence is: ucuuugguuaucuagcuguaugaQuestion 4.bUsing the same RNA “Stem-Loop” sequence in Question 4.a, what miRNA family does the Rfam “Search” feature (http://rfam.sanger.ac.uk/search) say it is likely a member of?

Answer = the miRNA’s are a member of mir-9/mir-79 (RF00237) microRNA precursor family.Question 4.cPer your answers to Questions 4.a and 4.b, would you say Rfam and miRBase provide similar or different results? Answer = Definitely, both of them produce the same results.

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Target Prediction Essay Example | Topics and Well Written Essays - 500 words”, n.d.)
Target Prediction Essay Example | Topics and Well Written Essays - 500 words. Retrieved from https://studentshare.org/biology/1584065-target-prediction
(Target Prediction Essay Example | Topics and Well Written Essays - 500 Words)
Target Prediction Essay Example | Topics and Well Written Essays - 500 Words. https://studentshare.org/biology/1584065-target-prediction.
“Target Prediction Essay Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/biology/1584065-target-prediction.
  • Cited: 0 times

CHECK THESE SAMPLES OF Target Prediction

Political Economic Organization

Name: University: Course: Tutor: Date: Political Economic Organization and the Production of Generalized Market Relations Question 1 a) Explain at least two ways that increasing productivity has been achieved, using the ideas of Adam Smith and Karl Marx.... As an example, Smith introduces that 10 workers can only produce 200 pins per day, which equals that a worker can produce 20 pins per day if they work alone....
7 Pages (1750 words) Essay

Target costing

target Costing Answer 1 Innumerable modifications were faced by Mercedes in 1990 facing stiff competition from the Lexus.... The pricing of the product afore mentioned ranged as its target customer rangers from the higher middle class to the bourgeois of the society.... Furthermore, Mercedes does not strictly follow target costing as the cost control measure of the company so as to produce the lowest priced product in its class (Cooper 163).... The target costing of a company mainly comprises of three components namely, target cost which is obtained by subtracting target profit from the target selling price of the product of the company....
4 Pages (1000 words) Case Study

Kaizen Costing and Target Costing

target costing is a process that determines and realizes total cost in a way that the total cost of producing a product must be traded off with the desired profit at its expected selling price in the future.... … The paper revolves around two costing techniques Kaizen and target costing.... In the Kaizen costing, actual costs are compared with target cost reductions under dynamic conditions.... target Costing Process: Mostly companies use target costing to project visible cost targets for any new products they seek to establish in the market....
8 Pages (2000 words) Essay

Attentional Blink and Attention

It impacts the attention when a sequence of visual stimuli (targets) are shown to the subject in rapid succession with such a speed that the subject usually fails to detect the next target in the… The detection of target is usually followed by a time span of 500 milliseconds, during this period the subsequent targets are missed (Gazzaniga & Bizzi, 2000).... The term blink is associated with this phenomenon because it is as if the first target triggers an eye An initial parallel stage is required to process every target so only a few ones get selected for in-depth processing....
4 Pages (1000 words) Research Paper

The Future of Fracking: New Rules Target Air Emissions for Cleaner Natural Gas Production

From the paper "The Future of Fracking: New Rules target Air Emissions for Cleaner Natural Gas Production" it is clear that environmental Protection Agency that is abbreviated as EPA stated that they were concerned about the high levels of pollution resulting from unsupervised fracking locations.... The article was written by Weinhold Bob and it is titled The future of fracking: New rules target air emissions for cleaner natural gas production....
1 Pages (250 words) Article

Biologics PRODUCTION AND MARKET

Biologics are generally prescribed to those patients who have shown poor response to other forms of treatment.... Biologics are increasingly being… In fact, the bio-tech industry has helped treat more than 200 diseases through 400 biological drugs according to Kaldre (2008).... Despite having small figures, biologics epresent a significant proportion of the pharmaceutical market according to Aagaard, Purdy, and Philpott (2010) who cite that in 2007 American consumers reportedly spent approximately $40 billion on biologics constituting about 13....
4 Pages (1000 words) Essay

The Corporations Production Target

The reporter states that Saccharine Beers Corporation's attention is drawn regarding dwindled production results way below the Corporation's production target in the past two weeks, as the Brewery Department weekly reports indicated.... hellip; In the regular departmental process review recommendations anticipated in the few coming weeks, the Brewery Department has found out that an urgent capacity outstretch management is needed....
4 Pages (1000 words) Assignment

Branch Prediction

The writer of the paper “Branch prediction” states that there are two facets to branch predictions; one being determining the results of a given branch that can either be taken or not taken and other being the target address knowledge in case of the taken outcome.... hellip; Branch prediction is a technique utilized by instruction pre-fetch processors in predicting whether a conditional branch is taken or not taken.... Branch prediction remains an important area of research in ways of improving parallelism in computing....
6 Pages (1500 words) Coursework
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us