quora
Nobody downloaded yet

Gene Prediction - Lab Report Example

Comments (0) Cite this document
Summary
Gene predictions can be done using three techniques; pattern based, content based and comparative based, in this prediction, pattern based technique was…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER96.8% of users find it useful
Gene Prediction
Read TextPreview

Extract of sample
"Gene Prediction"

Download file to see previous pages This corresponds to 331 codons also known as amino acids. The longest pattern always appears pink in color and the reading range was 1044 to 2039.
The longest genome pattern highlighted pink was then clicked and BLAST button again clicked, the BLAST button appears at the top of the page. The BLAST button sets all the parameters as default. To check the highest bit score given by the human genome, view report button was clicked to display the results. In the results, the highest bit score realized was 675 consistent to the identities 331/331 (100%) with positives of 331/331 (100%). Gaps related to this experiment was 0/331 i.e. 0%.
Still on the ORF Finder, when the button accept was clicked the longest ORF initially highlighted pink changed to green. 2 Fasta nucleotide was selected and view button clicked the sequence obtained is given below. Sequence 1 ORF: 1044 to 2039 Frame +3
ATGACTGCAAAGATGGAAACGACCTTCTATGACGATGCCCTCAACGCCTCGTTCCTCCCGTCCGAGAGCGGACCTTATGGCTACAGTAACCCCAAGATCCTGAAACAGAGCATGACCCTGAACCTGGCCGACCCAGTGGGGAGCCTGAAGCCGCACCTCCGCGCCAAGAACTCGGACCTCCTCACCTCGCCCGACGTGGGGCTGCTCAAGCTGGCGTCGCCCGAGCTGGAGCGCCTGATAATCCAGTCCAGCAACGGGCACATCACCACCACGCCGACCCCCACCCAGTTCCTGTGCCCCAAGAACGTGACAGATGAGCAGGAGGGCTTCGCCGAGGGCTTCGTGCGCGCCCTGGCCGAACTGCACAGCCAGAACACGCTGCCCAGCGTCACGTCGGCGGCGCAGCCGGTCAACGGGGCAGGCATGGTGGCTCCCGCGGTAGCCTCGGTGGCAGGGGGCAGCGGCAGCGGCGGCTTCAGCGCCAGCCTGCACAGCGAGCCGCCGGTCTACGCAAACCTCAGCAACTTCAACCCAGGCGCGCTGAGCAGCGGCGGCGGGGCGCCCTCCTACGGCGCGGCCGGCCTGGCCTTTCCCGCGCAACCCCAGCAGCAGCAGCAGCCGCCGCACCACCTGCCCCAGCAGATGCCCGTGCAGCACCCGCGGCTGCAGGCCCTGAAGGAGGAGCCTCAGACAGTGCCCGAGATGCCCGGCGAGACACCGCCCCTGTCCCCCATCGACATGGAGTCCCAGGAGCGGATCAAGGCGGAGAGGAAGCGCATGAGGAACCGCATCGCTGCCTCCAAGTGCCGAAAAAGGAAGCTGGAGAGAATCGCCCGGCTGGAGGAAAAAGTGAAAACCTTGAAAGCTCAGAACTCGGAGCTGGCGTCCACGGCCAACATGCTCAGGGAACAGGTGGCACAGCTTAAACAGAAAGTCATGAACCACGTTAACAGTGGGTGCCAACTCATGCTAACGCAGCAGTTGCAAACATTTTGA.
Fasta formatted sequence was ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words”, n.d.)
Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 words. Retrieved from https://studentshare.org/biology/1582933-gene-prediction
(Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 Words)
Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 Words. https://studentshare.org/biology/1582933-gene-prediction.
“Gene Prediction Lab Report Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/biology/1582933-gene-prediction.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document
CHECK THESE SAMPLES - THEY ALSO FIT YOUR TOPIC
Genetics
During this division in mitosis, the hereditary factors do not change. At meiosis, the division process has two general stages. At the first stage, the number of chromosomes is decreased twice. As a result of the
6 Pages(1500 words)Lab Report
Bioinformatics and gestational diseases
ROCK2, ACE, NOS3, H19, COMT, and STOX1 are all discussed as possibilities, though only H19 showed any serious promise as a causal link. Genes related to preeclampsia are more likely to be those related to cardiovascular function than to fetal growth or uterine health.
6 Pages(1500 words)Lab Report
Gene Splicing lab
5 Pages(1250 words)Lab Report
Gene technology
The insert (16s rDNA = 1.5 kb; plasmid = 3.5 kb). The band on our slide is dark and broad therefore exact size determination is difficult. However, the size is slightly more than 4.0 kb, which is near the expected
3 Pages(750 words)Lab Report
Student practical report (3 activities in one report). Activity 1: Semi-quantitative gene expression by reverse transcriptase- PCR (RT-PCR) analysis. Activity 2: Extract total RNA from mammal tissues. Activity 3: gels result
ast tumour and normal tissue specimens, and compare the amplified target cDNA to a constitutively expressed house-keeping gene, glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Dysregulated cell cycle control is a primary mechanism of cancer (Deshpande, Sicinski & Hinds,
6 Pages(1500 words)Lab Report
Detecting Cry1Ab gene in Mon0810 Transgenic Maize by PCR
After DNA is extracted from the maize, gel electrophoresis is done using agarose gel for the visibility of the DNA strands. A photograph of the amplified genes is then taken using a UV Trans illuminator. The photograph will provide a hard or soft copy of the DNA strands that
1 Pages(250 words)Lab Report
Experiment to determine the presence of a single nucleotide polymorphism in a gene
The SNP genomic distribution has no homogeneity. It always occurs in those regions that are non-coding. It has minimum occurrence in the regions that are coded. This is a case where the natural selection acts and fixes the SNP allele with favorable adaptation
4 Pages(1000 words)Lab Report
Bacterial transformation and gene expression
This research aims to evaluate and present bacterial transformation and gene expression. The research will demonstrate two important genetic engineering tools used for the expression of the foreign gene of interest in the given bacterial cell and three conditions required for the transformation.
8 Pages(2000 words)Lab Report
Per3 Gene and Diurnal Preference

The studies have found that a biallelic VNTR (variable number tandem repeat) polymorphism is present in the human PER3 gene at the chromosome 1p36.23, and it contains two alleles with 4 or 5 tandem repeats of 54 bp.This VNTR was evaluated as the important genetic factor for the chronotypes as it is associated with the diurnal preference.

7 Pages(1750 words)Lab Report
Fast plant lab report
The main objective of the experiment was to investigate the Mendelian Genetics with Wisconsin Fast Plants. In this case, the planted progeny seed (F2) from the self cross phenotypes were observed then a statistical analysis was carried out to determine how
4 Pages(1000 words)Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Let us find you another Lab Report on topic Gene Prediction for FREE!
logo footer
Contact us:
+16312120006
Contact Us Now
FREE Mobile Apps:
  • StudentShare App Store
  • StudentShare Google play
  • About StudentShare
  • Testimonials
  • FAQ
  • Blog
  • Free Essays
  • New Essays
  • Essays
  • Miscellaneous
  • The Newest Essay Topics
  • Index samples by all dates
Join us:
Contact Us