Nobody downloaded yet

Bioinformatics research - Dissertation Example

Comments (0) Cite this document
Summary
There is ocean of data available in various database generated from genome projects worldwide. In almost all organism most of the genome contains valuable information pertaining to a specific function or mere data that has not been deciphered. In the recent decades, advancements in the field of molecular biology coupled with Information technology enabled rapid sequencing of large genome data sets. …
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER91.3% of users find it useful
Bioinformatics research
Read TextPreview

Extract of sample "Bioinformatics research"

Download file to see previous pages Bioinformatics deals with data management in genomics and proteomics of all life forms. It is now accepted as a separate discipline in the main stream biology. Bioinformatics helps researchers worldwide to access various databases for research and to exchange information for comparison, prediction, storage and analysis. As on date, there are a number of databases specific to human, animals, plants and microbes. Bioinformatics accelerated the process of novel drug discovery and development drastically. In this present study bioinformatics tools and databases are used to find out novel genes and regulatory elements in regions in the nucleotide sequences with relevance towards glucose metabolism. The model generated from the experimentally verified data for transcription factors assist in the prediction of a specific transcription factors. Aspergillus nidulans is a fast growing, true filamentous fungi that belongs to the Ascomycetes family. It normally grows on a defined medium containing yeast extract and glucose serving as primary nitrogen and carbon sources respectively. The optimum growth temperature for the growth A.nidulans is 370C with good aeration. It doubles at every 1.5hr. A. nidulans is a homothallic, muticellular, haploid, spore former. It is capable of forming both sexual and asexual spores. The spherical conidiophore bears the uninucleate asexual spores called the conidia, which appear rough and range between 3-4 µm, these conidiophores are short and appear brown in colour. ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Bioinformatics research Dissertation Example | Topics and Well Written Essays - 5250 words”, n.d.)
Bioinformatics research Dissertation Example | Topics and Well Written Essays - 5250 words. Retrieved from https://studentshare.org/biology/1536209-bioinformatics-research
(Bioinformatics Research Dissertation Example | Topics and Well Written Essays - 5250 Words)
Bioinformatics Research Dissertation Example | Topics and Well Written Essays - 5250 Words. https://studentshare.org/biology/1536209-bioinformatics-research.
“Bioinformatics Research Dissertation Example | Topics and Well Written Essays - 5250 Words”, n.d. https://studentshare.org/biology/1536209-bioinformatics-research.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Bioinformatics research

Bioinformatics assignment

...?School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOUR PROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are related to the material in Section B. Task 8 is to be found in Section C and uses the peptide sequence that was allocated to you. Marks are shown in parentheses. Task 1 (no marks) Write down the peptide sequence (near the start of section...
4 Pages(1000 words)Assignment

Bioinformatics and gestational diseases

...genetics” and “bioinformatics” in separate searches added to the phrases. Relevance was determined if the article had certain key factors in the abstract when first viewed. These included the words “risk factors”, “gene”, “allele”, or other keywords relating to genetic sequencing and its use in determining risk for preeclampsia. Therefore, the article was determined to be relevant if it appeared to be related to statistically quantifying or codifying the genetic risk factors for preeclampsia Results One suggested genetic risk factor for preeclampsia was the rho-associated coiled-coil protein kinase 2, or the ROCK2 gene. The ROCK2 gene is located on chromosome 2p25, which previous research has suggested...
6 Pages(1500 words)Lab Report

Personal Statement for Bioinformatics Graduate Program

...Davis Veterinary School in 2009-2010, I became deeply aware of the vast amount of medical information stored and retrieved by accessing a database. This personal experience of the power and efficacy of computers impressed on me the importance of technology as a tool in research. I discovered that the hands-on processing of data gives me immense satisfaction. Gradually, my earlier interest in science and research shifted focus from the traditional bench sitting to a computer oriented approach. Therefore, in my junior year of college, I declared my major as Biotechnology, with a Bioinformatics option that combined my interests in both technology/informatics and biology/genetics. The...
4 Pages(1000 words)Personal Statement

Bioinformatics

...? Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database work 26th October Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene. 1) Using NCBI BLAST identify the most likely candidate for the complete gene. a. What is the name of the gene? Homo sapiens prion protein (PRNP) gene Gene ID: 5621 PRNP Query coverage of 100% E value of 2e-21 – [BLASTN 2.2.27+] (Zhang et al., 2000) b... . These...
6 Pages(1500 words)Assignment

Bioinformatics and molecular modelling

...?Bioinformatics and Molecular Modelling Bioinformatics and Molecular Modelling Part I and II Introduction Lipases are glycerol esters that often act on the triacylglycerols so that they cab release glycerol and acids. The major part of the lipases are used in industrial processes today are stemmed from animal or microbial sources. Notably, plant enzymes have some advantages over animals and microbial enzymes since they are available from natural sources with low costs and ease of purification. They widely exist in plant and microbial species, but with poor characterization of structure. Plant lipases are often considered to be involved in regulating certain plant growths and developments (Bos and...
8 Pages(2000 words)Essay

Bioinformatics

...- How would the mutation affect the coding sequence of the gene Mutations create variation within the gene pool. Less favorable (or deleterious) mutations can be reduced in frequency in the gene pool by natural selection, while more favorable (beneficial or advantageous) mutations may accumulate and result in adaptive evolutionary changes. Mutation is generally accepted by the scientific community as the mechanism upon which natural selection acts, providing the advantageous new traits that survive and multiply in offspring or disadvantageous traits that die out with weaker organisms. Changes in DNA caused by mutation can cause errors in protein sequence, creating partially or completely non-functional proteins. To function... How would the...
6 Pages(1500 words)Essay

Bioinformatics in cancer therapy

...Running Head: Research Proposal Research Proposal [Institute's Research Proposal Introduction Since few decades, medical science has advanced and progressed rapidly that has enabled physicians, therapists, surgeons, etc in carrying out their processes in an easy and efficient manner. Bioinformatics is one of the major indications of scientific achievements that are now contributing enormously to the field of medical science as well (Chinnaiyan, pp. 22-24, 2005). Experts (Coleman, pp. 161-63, 2004) have indicated that since few years, biological data has become a significant piece of information used by medical experts to understand different variations and sequences of...
8 Pages(2000 words)Research Proposal

Bioinformatics

...proteins EFR29682.1 a hypothetical protein from Anopheles darlingi it had an E value of 10. This protein is not in any way related to Down syndrome. This is a protein from mosquito saliva and matches by chance. This E value is high; its significance is low in relation to Down syndrome (Pevsner 7). Protein 2 is EGW12244.1 known as Down syndrome critical region protein 3–like from Chinese hamster (Cricetulus griseus). This protein has an E value of 1 and is related to Down syndrome since the E value is very low. The hamster genome is similar to the human genome (Pevsner 15). Protein 3 was XP_002122877 with an E value of 0.4 it is a protein predicted to be similar to Down syndrome critical region protein 3 (Down syndrome critical region...
1 Pages(250 words)Lab Report

Advanced Bioinformatics

...Bioinformatics as a Key Facilitator of Scientific Research of Learning Bioinformatics as a Key Facilitator of Scientific Research Nowadays the world opens numerous perspectives for development of different activities and fields. Bioinformatics is being developed at a full pace currently and this science facilitates the process of data processing in the field of biology. Different complicated issues and challenges in biology can be solved by means of this science. In spite of the fact that this field occurred in 1970, at our present time it opens huge prospects for development of biology. Moreover, on the background of a rapidly developing science, there...
4 Pages(1000 words)Essay

Job opportunity in bioinformatics

...another job area for bioinformatics. It involves the study of the origin of the species, together with the changes in their structures over the time they have been in existence. Bioinformatics helps the researchers to trace the path of evolution of many organisms by quantifying changes in their DNA other than by the physical taxonomy or physiological observations only. It also enables them perform a comparative analysis of entire genomes thus enabling the study of complex evolutionary events, like gene duplication, to forecast the behavior of the system for a long period. This helps bioinformatics professionals understand the structure of the human DNA and predict its...
5 Pages(1250 words)Term Paper
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Dissertation on topic Bioinformatics research for FREE!

Contact Us