Nobody downloaded yet

Bioinformatics and molecular modelling - Essay Example

Comments (0) Cite this document
Summary
Bioinformatics and Molecular Modelling Name Institution Bioinformatics and Molecular Modelling Part I and II Introduction Lipases are glycerol esters that often act on the triacylglycerols so that they cab release glycerol and acids. The major part of the lipases are used in industrial processes today are stemmed from animal or microbial sources…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER97.8% of users find it useful
Bioinformatics and molecular modelling
Read TextPreview

Extract of sample "Bioinformatics and molecular modelling"

Download file to see previous pages Plant lipases are often considered to be involved in regulating certain plant growths and developments (Bos and Laxminarayan, 2011; 42). They are mainly found in seeds where triglycerides are stored in the form of intracellular structures or the oil bodies. Lipases usually hydrolyze triglycerides to fatty acids and glycerol that produces energy needed for seed germination. The plant lapses are usually classified into three main groups with the first group consisting of the triacylglycerol hydrolases that are mainly found in seeds. Their study is vital since they are responsible for seed alteration especially during storage. The second group is the acylhydrolases that are found in various plant tissues. They often exhibit limited specificity for their substrates; therefore, they are unable to hydrolyze triglycerides. However, they are cable to catalyze some esterification processes or reactions (Appel and Feytmans, 2009; p. 68). The profound acylhydrolases include phospholipases A and B, sulfolipases, glycolipases, and monoglyceride lipases. The last group in this category is the phosphorlipases that involve plant metabolism, degradation, and rearrangement. Other than the above classification, the recent studies have led to different classification of lipases based on comparison of the sequences of their amino acid among other fundamental biological and physicochemical properties (Gupta, 2007; 34). This modern classification led to eleven subfamilies. Despite being a member of many protein families, the lipases often have similar architecture that is described by the ?-hydrolase fold. The activities of all lipases often rely on the catalytic triad that is usually fromed by the Asp, Ser, and His residues. In the sequence of the amino acid especially involving ?/? hydrolases, these three residues often follow the user-Asp-His order. Additionally, lipases often share the consensus sequence defined by the Gly-Xaa-Ser-Xaa-Gly where X may be a residue of an amino acid (Bos and Laxminarayan, 2011; p. 33). The three dimensional structure of any protein molecule often provides valuable insight into the molecular function, organization, docking stimulation, and the effective designing of drug experiments. The lack of an experimentally determined crystal structure, the homology modeling may be used to provide an opportunity in obtaining a reasonable 3D model. Currently, the 3D models often provide a perfect means of predicting the structure of biomolecules since it yields models that are suitable for a wide application spectrum that are structurally based thereby providing molecular design for mechanism investigation. The 3D approach is capable of providing a reasonable structure model that is often related to template that shares more than 25 percent sequence identity. An Arabidopsis thaliana lipase model is greatly proposed to investigate the model organism mainly in the plant biology since it is relatively small and and it is genetically tractable genome. Methods The Target and Template Proteins The model is perfect in determining adequate template for the homology modeling for the Arabidopsis thaliana. This sequence allows the alignment of amino acid sequence against the protein data bank (PDB) and this is performed by means of BLAST algorithm. According to the sequence algorithm, both the template (1HLG) and the target share 31 percent of the sequence identity. ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Bioinformatics and molecular modelling Essay Example | Topics and Well Written Essays - 2000 words”, n.d.)
Retrieved from https://studentshare.org/biology/1466563-bioinformatics-and-molecular-modelling
(Bioinformatics and Molecular Modelling Essay Example | Topics and Well Written Essays - 2000 Words)
https://studentshare.org/biology/1466563-bioinformatics-and-molecular-modelling.
“Bioinformatics and Molecular Modelling Essay Example | Topics and Well Written Essays - 2000 Words”, n.d. https://studentshare.org/biology/1466563-bioinformatics-and-molecular-modelling.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Bioinformatics and molecular modelling

Bioinformatics assignment

...?School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOUR PROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are related to the material in Section B. Task 8 is to be found in Section C and uses the peptide sequence that was allocated to you. Marks are shown in parentheses. Task 1 (no marks) Write down the peptide sequence (near the...
4 Pages(1000 words)Assignment

Bioinformatics

...? Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database work 26th October Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene. 1) Using NCBI BLAST identify the most likely candidate for the complete gene. a. What is the name of the gene? Homo sapiens prion protein (PRNP) gene Gene ID: 5621 PRNP Query coverage of 100% E value of 2e-21 – [BLASTN 2.2.27+] (Zhang et al., 2000) b... the...
6 Pages(1500 words)Assignment

Bioinformatics

...synthesis reaction to a mixture containing PCR components and the user supplied gene-specific primers. PCR reagents are not included in the First Strand cDNA Synthesis Kit. The Positive Control RNA and corresponding primers are useful for verifying system performance and identifying sample-related problems. The expected amplification product from the 3 kb Positive Control RNA is 1000 bp. References Primary Sources Berger, S.L. and Kimmel, A.R. (eds.) (1987) "Guide to Molecular Cloning Techniques", Meth. Enzymol. 152, Academic Press, Orlando. Chomczynski, P. and Sacchi, N. (1987) "Current Protocols in Molecular Biology" Anal. Biochem. 162, 156-159 John Wiley &...
6 Pages(1500 words)Essay

Bioinformatics in cancer therapy

...of bioinformatics in the cancer therapy and research, experts have indicated rapid and expanded amount of research on the tools of bioinformatics, and such tools are now becoming necessities during cancer therapies. Studies (Hollon, pp. 20-23, 2002) have specified that the major benefit of applying bioinformatics system is provision of updated information of biological changes in the patients' body on real-time basis. In particular, computerized models represent biological information in a quantitatively that allows the therapists to know about the quantity of cancer cells in the body and the biological state of the patient. Such facility has resulted in positive...
8 Pages(2000 words)Research Proposal

Modelling (Spreadsheet Modelling for OR)

...Introduction: Azerbaijan is one of the most populated regions, it is located neighbours east of Europe and west of Asia with an area of approximately 86,000 square kilometres, The population size according to the 2002 census showed that there are over 8 million individuals in the region, this adds up to a population density of 92 individuals per square kilometres. This paper studies the population growth rate and the mortality rate in this country; we study the population growth and mortality rate among the females in this region. Data: The following data was used to analyse the population characteristics in the country, the data below shows the female death rate in the last five years for every 1000 of initial population... Azerbaijan is...
3 Pages(750 words)Essay

Bioinformatics research

...Introduction There is ocean of data available in various database generated from genome projects worldwide. In almost all organism most of the genome contains valuable information pertaining to a specific function or mere data that has not been deciphered. In the recent decades, advancements in the field of molecular biology coupled with Information technology enabled rapid sequencing of large genome data sets. Bioinformatics utilizes methods from applied mathematics, informatics, statistics, and computer science to solve complex biological problems. Biological databases have become integral resources in assisting scientists to understand and interpret biological phenomena. Bioinformatics deals with data management in genomics... and...
21 Pages(5250 words)Dissertation

Bioinformatics

...proteins EFR29682.1 a hypothetical protein from Anopheles darlingi it had an E value of 10. This protein is not in any way related to Down syndrome. This is a protein from mosquito saliva and matches by chance. This E value is high; its significance is low in relation to Down syndrome (Pevsner 7). Protein 2 is EGW12244.1 known as Down syndrome critical region protein 3–like from Chinese hamster (Cricetulus griseus). This protein has an E value of 1 and is related to Down syndrome since the E value is very low. The hamster genome is similar to the human genome (Pevsner 15). Protein 3 was XP_002122877 with an E value of 0.4 it is a protein predicted to be similar to Down syndrome critical region protein 3 (Down syndrome critical region...
1 Pages(250 words)Lab Report

Molecular

...2nd October Problems for Chapter 3 C.3.6 Dice Suppose that you roll three fair dice. What is the probability of getting a five on at least one of the dice? Total outcomes in a dice {1 2 3 4 5 6} Probability of getting a five on one dice {event X) = 3 No. of possible outcomes in one dice = 3{1 2 3 4 5 6} = 18 P (X) = = In 3 dices the probability of getting at least a 5 = 3/18 = 1/6 C. Forensic DNA testing DNA found at a crime scene can be compared with DNA from suspected criminal to estimate the likelihood that both samples came from the same person. An enzyme is used to cut each DNA into short fragments; the enzyme always cuts at the same DNA sequence, and the positions of such sequences differ among individuals... October...
5 Pages(1250 words)Speech or Presentation

Advanced Bioinformatics

...as an effective and a powerful solution for data archive processing and information sharing. Bioinformatics plays a role of a cross-discipline, combining methods and approaches of mathematics and molecular biology, information and computer science and software engineering (Sear, p. 135). Tools and methods of bioinformatics will exert and important and a significant influence on quality of human lives improvement. Bioinformatics promotes techniques and methods of biomolecular sciences and is concentrated on evolution of the molecules, structure of biology and improvement of statistical analysis of DNA. This science is a key industry in drug and medicine discovery and it...
4 Pages(1000 words)Essay

Molecular Biology and Molecular Diagnostics

...Molecular Biology and Molecular Diagnostics Introduction The popularity of Health tips magazines is on the rise. The magazines are increasingly being appreciated because of their role of providing useful health information on various topics (Allison, 2009, p. 45). What is more, the magazines offer information on the most recent advances in molecular biology research, the most effective health practices, and beauty tips for (aging) women. Health tips magazines also address emotional, mental, fitness-related, dietary, and physical environment issues. The main topics discussed in health magazines include disease management, fitness, beauty, diet, well being, and nutritional implications....
2 Pages(500 words)Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Essay on topic Bioinformatics and molecular modelling for FREE!

Contact Us