StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Characterization of Gene and Its Product of Given Sequence Using Bioinformatics Tool - Essay Example

Cite this document
Summary
In the "Characterization of Gene and Its Product of Given Sequence Using Bioinformatics Tool" paper, the genomic sequence was obtained from retroviral transfected mice showing multiple tumors. The sequence was used to identify the gene and its role in tumor induction by BLAST, BLAT, and RTCGD search…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER94.6% of users find it useful
Characterization of Gene and Its Product of Given Sequence Using Bioinformatics Tool
Read Text Preview

Extract of sample "Characterization of Gene and Its Product of Given Sequence Using Bioinformatics Tool"

Download file to see previous pages

However, some reports are indicating the occurrence of tumors at a later stage in transgenic animals and that's why it is important to know the probability of nonspecific integration of this transgene and its effect on cellular homeostasis. As per the present understanding, the integration is semi-random in nature and has a partial preference toward sequences in or near the coding regions of expressed genes (1).

Integration in these places may lead to up or down-regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on the above observations, it is highly recommended to verify the insertion loci of given vectors in a model system. Based on bio-informatical analysis of the given sequence, we were able to demonstrate that the Viral vector integrates into the vicinity of a gene called Nfib (Nuclear factor I/B) and interferes with its normal functioning. Detailed investigation and database search indicate Nfib has a potential role in cell cycle regulation and oncogenesis.

Vectors, transfection, cloning, amplification, and sequencing were performed as per the previously mentioned protocol (1). For identification of the gene and its functionality sequence was BLAST against the Mouse genome database. Similarly, for further verification, the sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate the presence of similar gene entries in the database.

GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3'

Results and discussion: The sequence was used for similarity search by BLAST in the mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of a given sequence.FIG 1: BLAST results>ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6JLength=28591323 Features in this part of the subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/PlusQuery 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which indicates the given sequence belongs to a gene called nfib (Nuclear factor I/B).

It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is a member of the protein family having diverged roles in transcription and cell cycle regulation. Similarly, BLAT analysis retrieves the same gene against the query of a given sequence.

...Download file to see next pages Read More
Tags
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words”, n.d.)
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words. Retrieved from https://studentshare.org/science/1515241-gene-analysis
(Gene Analysis Essay Example | Topics and Well Written Essays - 1000 Words)
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 Words. https://studentshare.org/science/1515241-gene-analysis.
“Gene Analysis Essay Example | Topics and Well Written Essays - 1000 Words”, n.d. https://studentshare.org/science/1515241-gene-analysis.
  • Cited: 0 times

CHECK THESE SAMPLES OF Characterization of Gene and Its Product of Given Sequence Using Bioinformatics Tool

Flow Cytometry and Gel Electrophoresis

Molecular assessment has become a tool in clinical medicine.... In this regard, AFC is an important biomedical tool in the assessment of parameters of clinical sensitivity and resistance of specific bacterial strains to specific therapeutic regimens (Davey & Kell, 1996).... Mutations in DNA and protein structure can be identified using these molecular approaches.... Analytical flow cytometry (AFC) is used to assess the biochemical composition of cells using an optical scanner in the assessment of individual cells as they are screened individually at a rapid rate (approximately 100 cells per second) through an optical scanner (Boddy et al 2001; Givan 2001)....
9 Pages (2250 words) Essay

MYB26 Gene in Male Sterile and Another Dehiscence

megabases of the 125mb genome were sequenced ('Analysis of the genome sequence of the flowering plant Arabidopsis thaliana', 2000).... TAIR includes data on complete genome sequence with gene structure, gene product information, metabolism and gene expression, genome maps, genetic and physical markers, DNA and seed stocks, and all information about the Arabidopsis research community.... thaliana an ideal model plant in plant science research is its small genome size....
15 Pages (3750 words) Literature review

Protein Families

For analysis of gene and genomes from a functional perspective, comparative analyses of biochemical pathways are made along with deletion or mutant genotypes vs.... For analysis of gene and genomes from a functional perspective, comparative analyses of biochemical pathways are made along with deletion or mutant genotypes vs.... The paper deals with the analysis of protein families using bioinformatics programs such as Crescendo/CHARMM/Amber etc....
16 Pages (4000 words) Coursework

Role of Genetic Variations in Human Diseases

This led to accumulation of a wealth of knowledge about the genetics per se and its possible variations, and it took no time to find the links between complex diseases and practice of medicine, although its is still challenging to integrate genetics into the everyday practice of clinical medicine.... The prevalence of genetic diseases, combined with their severity and chronic nature, imposes a great financial, social, and emotional burden on society, and therefore research in this area is strongly indicated to solve the problems of application of this science into accurate characterization of the disease processes, so a clinical and therapeutic solution for these problems are accessible to both the medical community and the patients....
16 Pages (4000 words) Research Paper

Bioinformatics research

bioinformatics deals with data management in genomics and proteomics of all life forms.... bioinformatics helps researchers worldwide to access various databases for research and to exchange information for comparison, prediction, storage and analysis.... bioinformatics accelerated the process of novel drug discovery and development drastically.... In this present study bioinformatics tools and databases are used to find out novel genes and regulatory elements in regions in the nucleotide sequences with relevance towards glucose metabolism....
21 Pages (5250 words) Dissertation

Role of Genetic Variations in Human Diseases: Past, Present, Future

This led to the accumulation of a wealth of knowledge about the genetics per se and its possible variations, and it took no time to find the links between complex diseases and practice of medicine, although it is still challenging to integrate genetics into the everyday practice of clinical medicine.... Genetic polymorphism resulting in gene deletion invariably leads to loss of function and no production of the gene product.... This was in sharp contrast with the traditional approach of studying human diseases contemplated to be caused by relatively rare single-gene diseases, which cumulatively account for merely 10% of diseases appear in the pediatric age group....
16 Pages (4000 words) Research Paper

Biomedical Uses of Biotechnology: Flow Cytometry and Gel Electrophoresis

Molecular assessment has increasingly become an essential diagnostic and assessment tool in clinical medicine.... In this regard, AFC is an important biomedical tool in the assessment of parameters of clinical sensitivity and resistance of specific bacterial strains to specific therapeutic regimens (Davey & Kell, 1996).... Mutations in DNA and protein structure can be identified using these molecular approaches.... Flow Cytometry Analytical flow cytometry (AFC) is used to assess the biochemical composition of cells using an optical scanner in the assessment of individual cells as they are screened individually at a rapid rate (approximately 100 cells per second) through an optical scanner (Boddy et al 2001; Givan 2001)....
9 Pages (2250 words) Term Paper

Omic Technologies in Cancer Diseases

The author outlines that this technology has been pragmatic to different segments of CHM investigation starting from regularization and eminence regulation of herbal formularies, characterization of target mediated, and downstream effects.... An omic examination is widely being used in the discovery of drugs and assessment of the drug toxicity as well as its efficacy.... There has been researching carried out in obstetrics and gynecology and at the moment its taking advantage of these opportunities....
6 Pages (1500 words) Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us