Characterization of Gene and Its Product of Given Sequence Using Bioinformatics Tool - Essay Example

However, some reports are indicating the occurrence of tumors at a later stage in transgenic animals and that's why it is important to know the probability of nonspecific integration of this transgene and its effect on cellular homeostasis. As per the present understanding, the integration is semi-random in nature and has a partial preference toward sequences in or near the coding regions of expressed genes (1).

Integration in these places may lead to up or down-regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on the above observations, it is highly recommended to verify the insertion loci of given vectors in a model system. Based on bio-informatical analysis of the given sequence, we were able to demonstrate that the Viral vector integrates into the vicinity of a gene called Nfib (Nuclear factor I/B) and interferes with its normal functioning. Detailed investigation and database search indicate Nfib has a potential role in cell cycle regulation and oncogenesis.

Vectors, transfection, cloning, amplification, and sequencing were performed as per the previously mentioned protocol (1). For identification of the gene and its functionality sequence was BLAST against the Mouse genome database. Similarly, for further verification, the sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate the presence of similar gene entries in the database.

GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3'

Results and discussion: The sequence was used for similarity search by BLAST in the mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of a given sequence.FIG 1: BLAST results>ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6JLength=28591323 Features in this part of the subject sequence: nuclear factor I/B Score = 191 bits (103), Expect = 1e-46 Identities = 103/103 (100%), Gaps = 0/103 (0%) Strand=Plus/PlusQuery 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61 Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260 As seen above, 100% matching were obtained with very low E values (1e-46) which indicates the given sequence belongs to a gene called nfib (Nuclear factor I/B).

It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is a member of the protein family having diverged roles in transcription and cell cycle regulation. Similarly, BLAT analysis retrieves the same gene against the query of a given sequence.