Nobody downloaded yet

Gene Analysis - Essay Example

Comments (0) Cite this document
Summary
Retroviral based gene delivery system is widely used in gene therapy but there are many evidences indicating its catastrophic role in tumor induction, as it can integrate into different places of genome and cause insertion mutagenesis. In the present study the genomic sequence was obtained from retroviral transfected mouse showing multiple tumors…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER96.3% of users find it useful
Gene Analysis
Read TextPreview

Extract of sample
"Gene Analysis"

Download file to see previous pages Gene therapy, integrating vectors carrying therapeutic transgene sequences offers the potential for a permanent cure of genetic diseases by stable vector insertion into the patients chromosomes (1). However there are some reports indicating occurrence of tumors at later stage in transgenic animal and that's why it is important to know probability of non specific integration of this transgene and its effect on cellular homeostasis. As per the present understanding the integration is semi-random in nature and having partial preference towards sequences in or near the coding regions of expressed genes (1). Integration in these places may lead to up or down regulation of that particular gene and hence increase the probability of interference in cellular homeostasis. Based on above observations, it is highly recommended to verify the insertion loci of given vectors in model system. Based on bio-informatical analysis of given sequence, we were able to demonstrated that Viral vector integrates in vicinity to gene called Nfib (Nuclear factor I/B) and interferes with it normal functioning. Detailed investigation and database search indicates Nfib has potential role in cell cycle regulation and oncogenesis.
Vectors, transfection, cloning, amplification and sequencing were performed as per previously mention protocol (1). For identification of gene and its functionality sequence was BLAST against the Mouse genome database (http://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgitaxid=10090). Similarly for further verification, sequence was BLAT (http://genome.brc.mcw.edu/cgi-bin/hgBlat) and also compared in RTCGD (http://rtcgd.abcc.ncifcrf.gov/). , to investigate presence of similar gene entry in the data base.

GeneSequence: 5'AAAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAATAATAAA AGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 3'
Results and discussion:
The sequence was used for similarity search by BLAST in mouse genome database. All the default parameters were kept without changing for identification of match. Fig 1 shows results obtained after BLAST of given sequence.



FIG 1: BLAST results
>ref|NT_039260.7|Mm4_39300_37 Mus musculus chromosome 4 genomic contig, strain C57BL/6J
Length=28591323

Features in this part of subject sequence:
nuclear factor I/B


Score = 191 bits (103), Expect = 1e-46
Identities = 103/103 (100%), Gaps = 0/103 (0%)
Strand=Plus/Plus

Query 2 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 61

Sbjct 21590158 AAAATGGTATATATAGAGTCTTGTCTTTGGTGACTAGGAAAAGTCAGTAAAGGAATGAAT 21590217

Query 62 AATAAAAGACAGCCAGTTGAAGGAAGAtttttttttttCAATT 104

Sbjct 21590218 AATAAAAGACAGCCAGTTGAAGGAAGATTTTTTTTTTTCAATT 21590260


As seen above, 100% matching were obtained with very low E values (1e-46) which clearly indicates the given sequence belongs to gene called nfib (Nuclear factor I/B). It is located on chromosome 4 (Chr4:81761404-82176981 bp, - strand). Nfib is member of protein family having diverged role in transcription and cell cycle regulation.
Similarly BLAT analysis retrieves same gene against the query of given sequence. ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words”, n.d.)
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 words. Retrieved from https://studentshare.org/science/1515241-gene-analysis
(Gene Analysis Essay Example | Topics and Well Written Essays - 1000 Words)
Gene Analysis Essay Example | Topics and Well Written Essays - 1000 Words. https://studentshare.org/science/1515241-gene-analysis.
“Gene Analysis Essay Example | Topics and Well Written Essays - 1000 Words”, n.d. https://studentshare.org/science/1515241-gene-analysis.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document
CHECK THESE SAMPLES - THEY ALSO FIT YOUR TOPIC
The analysis of the business strategies of Gene one
The study reveals the present situation and condition in Gene One which has entered into the biotechnology industry and specializes in technologies which eradicates diseases in potatoes and tomatoes. Firstly a brief description of the situation in Gene One is presented.
11 Pages(2750 words)Research Paper
Analysis MYB26 gene and male sterile and Anther dehiesence
It is an annual weed (rarely biannual) originated in Europe, Asia and north western Africa and in temperate regions of the world (NASC, 2011). It is naturally found in poor sandy or gravelly soil and can find in wastelands, car parks and railway sides. Plant height at maturity is around 20-25cm and it produces small white flowers 3mm in diameter and is naturally self-pollinated.
15 Pages(3750 words)Literature review
Molecular biology cloning and Brachyury gene
Cloning entails the intensification of specific DNA segments, leading to the buildup of large amounts of similar DNA fragments, which may be utilized for numerous functions. Conventional molecular cloning uses tailored DNA cloning vectors, which are usually derived from spherical DNA molecules identified as bacterial plasmids.
4 Pages(1000 words)Essay
Gene One
Gene one has revolutionized the manner in which farmers preserve tomatoes and potatoes. Gene One is currently conducting research that will rapidly expand the crops that can benefit from Gene One's gene technology that presents crops from becoming diseased and is hopeful that their research will speed up the growth rate of multiple crops.
6 Pages(1500 words)Essay
Is There a Gay Gene
The genetics of sex-determination itself is clearly defined and under the influence of a single gene, Sry, the testis determining gene, located on the Y chromosome. Sry is the only gene required to establish male development. Researchers first suspected that homosexuality might also be gene-related when they studied the occurrence of gayness in siblings.
5 Pages(1250 words)Essay
Gene Determination
The process of sexual determination and thus the genital appearance of the baby at birth are largely determined by the presence or absence of genetic and hormonal influences responsible for the process of male differentiation. The gene SRY on the short arm of the Y chromosome has been described as the major player in this process.
7 Pages(1750 words)Essay
Gene Manipulation
Genes have already been found out of Cystic fibrosis, Huntington's disease. Fragile X syndrome, cancer of the breast, the incurable Alzheimer's disease, cancer of colon, bipolar disorder, obesity, sexual orientation, and alcohol related disorders, "crime, timidity, bed wetting; etc.
9 Pages(2250 words)Essay
Gene Silencing
Characterization of such genes has evolved hope in the management of cancer. It has been proposed that detection of gene silencing in certain genes which are characteristic of tumors can help not only in early detection, but also may enhance the development of novel
6 Pages(1500 words)Essay
Gene
eotide sequence that can possibly produce such oligopeptide, the sequences upstream and downstream of it will be used to identify sequences compatible with restriction enzyme digestion. Upon treatment of the purified mouse DNA with restriction enzymes, the isolated DNA
8 Pages(2000 words)Essay
What is the current status of clinical gene therapy trials for Chronic Granulomatous Disorder
ns of the disease further reflect in the ‘inability’ of phagocytes to make ‘reactive oxygen species’ because of the lack or malfunction of NADPH complex, and thus the ‘susceptibility to infection increases’ in the affected population (Kepenekli 2014: 1). Evidence
6 Pages(1500 words)Essay
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Let us find you another Essay on topic Gene Analysis for FREE!
Contact us:
+16312120006
Contact Us Now
FREE Mobile Apps:
  • About StudentShare
  • Testimonials
  • FAQ
  • Blog
  • Free Essays
  • New Essays
  • Essays
  • Miscellaneous
  • The Newest Essay Topics
  • Index samples by all dates
Join us:
Contact Us