StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Bioinformatics - Essay Example

Comments (0) Cite this document
Summary
Mutations create variation within the gene pool. Less favorable (or deleterious) mutations can be reduced in frequency in the gene pool by natural selection, while more favorable (beneficial or advantageous) mutations may accumulate and result in adaptive evolutionary changes.
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER95.1% of users find it useful
Bioinformatics
Read TextPreview

Extract of sample "Bioinformatics"

Download file to see previous pages To function correctly, each cell depends on thousands of proteins to function in the right places at the right times. When a mutation alters a protein that plays a critical role in the body, a medical condition can result. A condition caused by mutations in one or more genes is called a genetic disorder. Some mutations alter a gene's DNA base sequence but do not change the function of the protein made by the gene. Studies in the fly Drosophila melanogaster suggest that if a mutation does change a protein, this will probably be harmful, with about 70 percent of these mutations having damaging effects, and the remainder being either neutral or weakly beneficial (Sawyer , et al 2007).If a mutation is present in a germ cell, it can give rise to offspring that carries the mutation in all of its cells. This is the case in hereditary diseases. On the other hand, a mutation can occur in a somatic cell of an organism. Such mutations will be present in all descendants of this cell, and certain mutations can cause the cell to become malignant, and thus cause cancer (Ionov , et al 1993).
Although many mutations are deleterious, mutations may have a positive effect given certain selective pressures in a population. For example, a specific 32 base pair deletion in human CCR5 (CCR5-32) confers HIV resistance to homozygotes and delays AIDS onset in heterozygotes(Sawyer , et al 2007). The CCR5 mutation is more common in those of European descent. One theory for the etiology of the relatively high frequency of CCR5-32 in the European population is that it conferred resistance to the bubonic plague in mid-14th century Europe. People who had this mutation were able to survive infection; thus, its frequency in the population increased(Ionov , et al 1993). It could also explain why this mutation is not found in Africa where the bubonic plague never reached. Newer theory says the selective pressure on the CCR5 Delta 32 mutation has been caused by smallpox instead of the bubonic plague(Galvani and Slatkin, 2003).
- Render the alignment into a box-shaded diagram. Identify the position of the mutation on the multiple sequence alignment. Can you deduce anything from these data Check that your sequences are appropriately gapped .
3'-AA/860 bp insert :
5'-TTTCATGA----- //----- TCATGAAA-3'
3'-AAAGTACT----- //----- AGTACTTT-5'
3'-TT/860 bp insert :
5'-AATCATGA----- //----- TCATGATT-3'
3'-TTAGTACT----- //----- AGTACTAA-5'
3'-CC/860 bp insert :
5'-GGTCATGA----- //----- TCATGACC-3'
3'-CCAGTACT----- //----- AGTACTGG-5'
3'-GG/860 bp insert :
5'-CCTCATGA----- //----- TCATGAGG-3'
3'-GGAGTACT----- //----- AGTACTCC-5'
Note that for each respective PCR product, the last eight bases at each 3'-end of the DNA are identical. Also note that only the first two and the last two base pair positions vary between the four PCR products. The PCR products were designed in this way to directly measure the effect of 3'-base composition on blunt vector and T-vector efficiency (Novy, Yaeger, and Kolb, 2008).
From the human protein sequence, present any Prosite motif and conserved sequence domains in a sequence diagram. Identify the position of the mutation on the diagram. Can you deduce anything from these data
Representative Sequence Length Mass (Da) A2QKA5
Checksum: FF7C4CB42EEB5629
385 41,846
10 20 ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Bioinformatics Essay Example | Topics and Well Written Essays - 1500 words”, n.d.)
Bioinformatics Essay Example | Topics and Well Written Essays - 1500 words. Retrieved from https://studentshare.org/miscellaneous/1507686-bioinformatics
(Bioinformatics Essay Example | Topics and Well Written Essays - 1500 Words)
Bioinformatics Essay Example | Topics and Well Written Essays - 1500 Words. https://studentshare.org/miscellaneous/1507686-bioinformatics.
“Bioinformatics Essay Example | Topics and Well Written Essays - 1500 Words”, n.d. https://studentshare.org/miscellaneous/1507686-bioinformatics.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Bioinformatics

Bioinformatics assignment

...?School of Health Science Techniques and Applications in Molecular Biology (PRINT)……………………………………….. YOUR ID………………………………………….. YOUR PROGRAMME (circle): Biol / BMS / HNC / other…………….............. Bioinformatics assignment – exploring proteins using bioinformatics tools. This completed proforma must be submitted via the coursework receipting office together with a completed receipt proforma. Please put ……….. as the member of staff who is to receive the work. Tasks 1-7 are related to the material in Section B. Task 8 is to be found in Section C and uses the peptide sequence that was allocated to you. Marks are shown in parentheses. Task 1 (no marks) Write down the peptide sequence (near the start of section B) in single letter format (put...
4 Pages(1000 words)Assignment

Bioinformatics and gestational diseases

...that were related to the gestational disease preeclampsia. An additional search restriction was added to that the articles had to be published after 2005, to ensure that only recent results that are currently considered to be accurate are used. An additional search was done on ScienceDirect and PubMed for relevant articles. However, the parameters above returned no results within the ScienceDirect database and very few on PubMed, so the search was re-done with slightly different terms. The search was designed to restrict only to journals generally in the subject areas of molecular genetics or bioinformatics, but may not have had those keywords in the journal name. The same set of keywords was used, with the additional keywords of...
6 Pages(1500 words)Lab Report

Personal Statement for Bioinformatics Graduate Program

...confirmed that my special interest lay in the field of bioinformatics and its application in genetic/genomic studies. Craving further practical experience in this field, I opted for internships at different laboratories: Theg Lab, UC Davis; Molecular Anthropology Laboratory, UC Davis; Dubcovsky Wheat Genetic Lab, UC Davis; Neale Lab, UC Davis. These laboratory internships spanned the area of Genetics and Bioinformatics, from Proteomics and Primate, Wheat and Forest Genetics to Data management, scripting, processing and parsing. This academic immersion in the convergence of Genetics and Informatics made me increasingly aware that the power of Genetics in the battle against chronic disease is increased...
4 Pages(1000 words)Personal Statement

Bioinformatics

...? Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database work 26th October Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene. 1) Using NCBI BLAST identify the most likely candidate for the complete gene. a. What is the name of the gene? Homo sapiens prion protein (PRNP) gene Gene ID: 5621 PRNP Query coverage of 100% E value of 2e-21 – [BLASTN 2.2.27+] (Zhang et al., 2000) b... Health...
6 Pages(1500 words)Assignment

Bioinformatics and molecular modelling

... thereby yielding oligoribonucleotide fragments that are characteristic of the two IREs countained in the TfR 3’ UTR. Finally, it worth noting that the two IRE often interacts where IRE-binding proteins often iteract with the ferritin IRE. References Abraham, N. G. (1999). Molecular biology of hematopoiesis 6: [proceedings of the Eleventh Symposium on the Molecular Biology of Hematopoiesis, held June 25-29, 1998, in Bormio, Italy. New York [u.a.], Kluwer Academic/Plenum Publishers. Acton, Q. A. (2012). Issues in bioengineering and bioinformatics. Atlanta, Ga, ScholarlyEditions. Appel, R. D., & Feytmans, E. (2009). Bioinformatics: a Swiss perspective. Singapore, World Scientific Pub. Bos, L., & Laxminarayan, S. (2011). Future visions...
8 Pages(2000 words)Essay

Bioinformatics in cancer therapy

..., biological data consists of huge amount of minute information regarding protein sequences, genomic sequences, etc that is not a thing of manual handling (Gordon, pp. 57-58, 2008). For this purpose, bioinformatics is playing a leading role in managing and handling huge amount of biological information with the help of information technology that has been very beneficial for medical science (HCR, 2008). In specific, it has enabled medical experts (Clauser & Reeve, pp. 5049-50, 2007) to understand biological processes of the human body by just making some clicks on the computer that has been helpful in various treatments, especially treatments and therapies for the cancer. Statement of the Problem In this regard, the proposed research...
8 Pages(2000 words)Research Proposal

Bioinformatics research

...and proteomics of all life forms. It is now accepted as a separate discipline in the main stream biology. Bioinformatics helps researchers worldwide to access various databases for research and to exchange information for comparison, prediction, storage and analysis. As on date, there are a number of databases specific to human, animals, plants and microbes. Bioinformatics accelerated the process of novel drug discovery and development drastically. In this present study bioinformatics tools and databases are used to find out novel genes and regulatory elements in regions in the nucleotide sequences with relevance towards glucose metabolism. The model generated from the experimentally...
21 Pages(5250 words)Dissertation

Bioinformatics

...hamster (Cricetulus griseus). This protein has an E value of 1 and is related to Down syndrome since the E value is very low. The hamster genome is similar to the human genome (Pevsner 15). Protein 3 was XP_002122877 with an E value of 0.4 it is a protein predicted to be similar to Down syndrome critical region protein 3 (Down syndrome critical region protein A). It is a protein from Ciona intestinalis, an invertebrate that is closest to humans and shares 80 % of the genome. It has very high significance in the study of Down syndrome. Works Cited Selikowitz.M. Down Syndrome.New York: Singage, 2008. Print. Pevsner,J. Bioinformatics and Functional genomics.London: Oxford, 2009. Print. “ Proteins”.www.ncbi.nlm.nih.gov/. Web. 8th Nov....
1 Pages(250 words)Lab Report

Advanced Bioinformatics

... and computer sciences. Bioinformatics is mainly directed on facilitation of ideas and obtained data. Biological research turns into an interesting and not a really hard task, when computer deals with information processing. These days bioinformatics is focused on answering the following questions: a question about new genes, protein functioning, finding the difference between healthy cell genes and cancer cells genes etc. As far as we can see, these global biological issues are solved from a quite different perspective. Bioinformatics reconsiders previous approaches and methods used in biology, and make them more advanced and modern, while there is a combination with computer science and information techniques. There are some exact...
4 Pages(1000 words)Essay

Why bioinformatics and proteomic application essential in the diagnosis of complex disease such as cancer

... was collected all over Europe. However, the article’s limitation is that it does not clearly distinguish the number of females and males plus kids in the study. Martin, J., Regad, L., Etchebest, C., & Camproux, A. (2008). Taking advantage of local structure descriptors to analyze interresidue contacts in protein structures and protein complexes. Proteins: Structure, Function, and Bioinformatics, 73(3), 672-689. 3-Duh, Q. (2004) It is noteworthy that the article first describes cancer as caused by the alteration of not only the proteome, but also a genome. These changes inculcate the ability to evade normal cellular control mechanism on cancer cells hence prompting its uncontrolled growth. The article further demonstrates that prior...
2 Pages(500 words)Annotated Bibliography

Job opportunity in bioinformatics

... directly and indirectly linked to it. This paper presents some of the employment opportunities. The first job opportunity that bioinformatics presents are sequence analysis. Sequence analysis was first done in 1977 when the phage Φ-X174 was sequenced. The job involves decoding DNA sequences and storing the information in databases. The sequence analysts then analyze the data to find out the genes that code for proteins and other structures in the sample. This has led to the discovery that comparing the genes within organisms of the same species, or different species reveal similarities in the functionality of their proteins. However, the growing amounts of data, means that it is no longer possible to analyze DNA sequences...
5 Pages(1250 words)Term Paper

Bioinformatics Analysis of Aspergillus Flavus Urate Oxidase

... by cloning and sequencing a complementary DNA (cDNA) prepared from messenger RNA (mRNA) transcripts of the uricase gene in this microorganism (Legoux et al. 1992). The following essay is the product of data on the genetic origins of this DNA sequence with respect to gene identification by sequence homology, predicted amino acid sequence, protein structure and functional assessment and comparative genomics results obtained by the use of bioinformatics to assess nucleotide sequences. DNA sequence analysis The DNA sequence of the uricase gene of Aspergillus flavus was originally determined by cloning and sequencing a complementary DNA (cDNA) prepared from messenger RNA (mRNA) transcripts of the uricase gene in this microorganism...
11 Pages(2750 words)Research Paper
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Essay on topic Bioinformatics for FREE!

Contact Us