Hacker Target and Response - Assignment Example

Comments (0) Cite this document
Summary
The foundational aims of information security systems are integrity, privacy, and accessibility (Covaleski, 2013). Information security systems are vital to an…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER93.6% of users find it useful
Hacker Target and Response
Read TextPreview

Extract of sample "Hacker Target and Response"

Download file to see previous pages The principal objective of this paper is to identify the areas and the information that an attacker might want to obtain and the methods that they may employ in undertaking the criminal activity. The paper also seeks to highlight the possible damage that their activities may cause to the information system. It is also important to show the preventive measures and the appropriate responses towards the security threat.
As said earlier in the paper, one of the probable offenders is an ex-employee of an organization. The reason for this is that the ex-employee might have negative motives of releasing sensitive information that could destroy the reputation of the organization. The primary objective of an ex-employee would be to revenge. Another area that could be attacked by the ex-employee is the financial security system. The offender could have an objective of crumbling the organizations financial stability. The terminated employee may also target the organization’s foundational information, its economic weaknesses, production information and organizational information (Covaleski, 2013).
There are multiple ways in which the terminated employee may use to hack into the company’s information system. One of the ways is using other employees to obtain information; the other means they could employ is to use their knowledge of security passwords and access the organization’s information system.
A well-planned data security strategy alternatively posits the objectives of the information system of a business and formulates a plan to attain these goals (Dhillon & Backhouse, 2000). Any leakage of sensitive corporate information is a pragmatic basis of corporation collapse. Precisely the data system lacking a prolific information security is prospective to be a separate collection of check procedures that include numerous severe security threats. Information systems security policies at that instance may frequently be ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Hacker Target and Response Assignment Example | Topics and Well Written Essays - 1500 words”, n.d.)
Hacker Target and Response Assignment Example | Topics and Well Written Essays - 1500 words. Retrieved from https://studentshare.org/information-technology/1687917-hacker-target-and-response
(Hacker Target and Response Assignment Example | Topics and Well Written Essays - 1500 Words)
Hacker Target and Response Assignment Example | Topics and Well Written Essays - 1500 Words. https://studentshare.org/information-technology/1687917-hacker-target-and-response.
“Hacker Target and Response Assignment Example | Topics and Well Written Essays - 1500 Words”, n.d. https://studentshare.org/information-technology/1687917-hacker-target-and-response.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Hacker Target and Response

Hacker Culture and Cyber Security Issues

...in phone hacking where individuals were breaking through telephone systems in United States and United Kingdom so as to have free calls connections. This skill was first discovered by John Draper who manipulated telephone systems using 2600 hertz tones to connect to free services. Having a whistle out of a blue box, he was able to access long distance telephone services freely (Elias, 2012). Soon after telephone hacking era, hackers started targeting computer systems. This is because computers not only give hackers information and data that they need but allows delivery of the same information from one place to the other. Hackers can now access internet networks using...
10 Pages(2500 words)Assignment

Hacker Culture

...?Introduction According to Sterling (1993) definition, “The Hacker Crackdown”, the term “hacking” is the act of intruding into computer systems by stealth and without permission.” The word hacker is highly used by computer programmers because hackers are able to crack the codes in the programming language. They seek to exploit the weaknesses in a computer system or a network to be able to access confidential documents and files. The most targeted systems are online businesses, organizations websites, and government websites, among others. For example, in the case of Wisconsin department of revenue, hackers try to change some figures on revenue by finding...
8 Pages(2000 words)Research Paper

Project Paper: Thinking like a hacker to protect your network

...internet access are likely to occur. With that known, one should ensure that the network security of such network components with public IP address are set up in a way that frustrates any possible hacker making them ignore and move on to the next target. One should therefore ensure that basic security policy including strong and effective firewall is in place on the network (Laet & Schauwers, 2009). A number of hackers tend to exploit protocol ports on which the internet is built, that is , the TCP/IP protocol. The TCP ports are the most targeted ports give that they utilized by most servers such as web servers, mail servers and other servers which are constantly...
7 Pages(1750 words)Essay

Computer Hacker

...is that it infringes on other people’s privacy. More so, since technology levels also keep rising steadily, the future of computer hacking seems bright, as computer hackers will learn and evolve with the increasing technology. However, ethical hackers will also use the advanced technology to offer increased system security to organizations. Either way, computer hacking affects all countries, therefore, it should be the collective responsibility of countries to adopt strategies that will help to curb computer hacking. References Levy, S. (2010). Hackers: Heroes of the computer revolution. California: Octal Publishing Inc. Skibell, R. (2002). The Myth of the Computer...
6 Pages(1500 words)Research Paper

Target Company

.... Target employs excellent managers and experts I would like to work with. This function is concerned with dividing work and allocating it among employees and determining their responsibilities and relations. At Target, all employees come from different cultural and social environment; they have different social statuses and class location, different religious beliefs and belong to different cultures. These differences create a certain tension between employees which requires special intervention actions of organizing activities to manage workforce diversity (www.target.com). Target should hire me because I am a professional in my field, career-oriented person and have...
3 Pages(750 words)Case Study

Hacker Hunters

...CASE STUDY---HACKER HUNTERS Answer The contemporary era is the era of information technology, where fast and speedy flow of information is the keyto success for the great brands and multinational organizations carrying vast business volume and sound corporate reputation at global level. The most meaningful way, Gates observes, to differentiate your company from your competitor, the best way to put distance between you and the crowd is to do an outstanding job with information and management. How you gather, manage, and use information will determine whether you win or loose. (1999: 2) Fast information technology provides the retailers a comprehensive, an accurate and detailed picture of the entire socioeconomic, cultural...
4 Pages(1000 words)Essay

Hacker Gary McKinnon

...Hacker Gary McKinnon Gary McKinnon, the systems administrator from Scotland, is the alleged hacker behind the US Military and NASA computer hacking between the years 2001 and 2002. This notorious hacker taught the world about the importance of security measures to be adopted to stop hackers from accessing highly confidential data. Thesis statement: Tight security measures with the help of security programs, effective preventive measures, and regular security verification could have prevented Hacker Gary McKinnon from hacking US Military and NASA computers. What could have been done to stop the hacker? First of all, Gary McKinnon’s...
2 Pages(500 words)Essay

Target Prediction

..., or coordinates, for “mmu-mir-223”? Answer = “mmu-mir-223” can be genetically mapped to ChrX:93438156-93438265 bp, + strand Question 1.f What is the “Stem-loop” sequence for “mmu-mir-223”? Answer = The “Stem-loop” sequence for “mmu-mir-223” is: UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG Question 1.g What is the “Mature” sequence for “mmu-mir-223”? Answer = The “Mature” sequence for “mmu-mir-223” is: >mmu-miR-223-3p MIMAT0000665 UGUCAGUUUGUCAAAUACCCCA >mmu-miR-223-5p MIMAT0017056 CGUGUAUUUGACAAGCUGAGUUG Question 2.a Using TargetScanHuman (http://www.targetscan.org/vert_50/), species set to “Mouse”, and all other search criteria kept at default settings, how many...
2 Pages(500 words)Essay

Hacker Culture and Mitigation

...Hacker Culture and Mitigation Introduction 3 Hacker’s culture 3 Mitigation/ measures 4 Past incidents in cyber crime 5 Identity theft 5 Online stalking 5 Third party involvement. 6 Methods employed by organization to discourage hackers. 6 Conclusion 7 References 9 Hacker Culture and Mitigation Table of Contents Introduction 3 Hacker’s culture 3 Mitigation/ measures 4 Past incidents in cyber crime 5 Identity theft 5 Online stalking 5 Third party involvement. 6 Methods employed by organization to discourage hackers. 6 Conclusion 7 References 9 Introduction The most thrilling trends of the early 21st century have been the outburst of...
5 Pages(1250 words)Assignment

Timeliness, Bandwidth and Other Factors Essential When Performing Scans or Enumeration

...of scanning is for the ethical hacker to determine which part of the system is alive and responsive within the overall organizational network (Henry, 2012). Some of the underlying scanning protocols and techniques employed include transmission control protocols (TCP), and the Internet Control Message Protocol (ICMP). In most cases, the information related to the targets that are gathered during this reconnaissance stage is extensive. Therefore, it is essential that the ethical hacker determines first which of the systems within the network appear to be responsive and live. As for the unresponsive systems, the scanning might miss them out; however,...
12 Pages(3000 words)Term Paper
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Assignment on topic Hacker Target and Response for FREE!

Contact Us