StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Product Development Sequence - Research Paper Example

Cite this document
Summary
In the paper “Product Development Sequence” the author analyzes the importance of rapid and punctual developments and the improvement of time performances. Studies show that the lesser the time the new product takes to develop, the lesser the time it will take to grow and establish…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER95.2% of users find it useful
Product Development Sequence
Read Text Preview

Extract of sample "Product Development Sequence"

Product Development Sequence ‎ In order to develop new products, the organizations have now recognized the importance of rapid and punctual developments and the improvement of time performances. As the business world rushes the competitive use of emerging technologies and developing new products, the organizations involve in the process of new product development. Studies show that the lesser the time the new product takes to develop, the lesser the time it will take to grow and establish. The time performance of the product development is very important as it suggests the organizations to reduce the time taken for the development of the product from the initial stage till it reaches to the customer. However, there are a number of approaches to reduce the product development growth time, and the emerging technology plays an immense role. The organizations form their approaches which may be strategic, systematic and synergistic. This is very important as the increasing competition is leading the firms to develop their products in a lesser time than their competitors. This accelerated new product development forces the companies to incorporate new innovated technologies into the products to achieve innovation success and improve profitability (Filippini et al, 2004). The e-business research field has enabled the businesses to emerge more and more e-business theories, applications and technologies to outline and stimulate information into research and business communities. It allows the businesses to form competitive and effective growth in product development. During the studies, the researchers found many ways in which the e-business applications can be applied. The time efficiency was influenced by a number of factors in the organizations including standardization, supplier partnership, concurrent engineering and cross-functional teams. However the synergistic approach suggested that the key factor to the concurrent engineering was teamwork, and on the other hand it was emphasized that the cross-functional teams would have greater influence on the product development time performance if they are communicated well. Thus this is where the technological emerges in the product development. Many of the research methods including theoretical, experimental, case and survey research methods are used in order to advance the business methods used in new product development. They enhance the e-business techniques as an emerging technology into the growth of the business, and help in bringing the product to an established level. As many companies saw the increased potential benefits of the e-business, they have now begun to capitalize in it. E-business reinforces the use of information and communications in every business activity. It also enables the business to focus on the use of information and communication to interact with the external activities of the business and form relationships with external groups and individuals for their new product development sequence. Project managers usually ensure better product performances if the communication technologies are efficiently used. Thus, e-business technologies that enhance the networking amongst drivers and external links can bring a boost in the growth of the new product development. Many of these technologies have recently emerged in many businesses and formed a successful interaction link between all those who are joined in the product development. These technologies are introduced in order to improve the teamwork which would eventually reduce the time performance for each product and will enable the concurrent engineering to be carried out (Brown, 2004). The new innovated technologies that enabled stronger communication were the use of better communications devices which were new, modern and much easier to use than other communication methods. Many studies have shown the use of modern communication devices that are developed for the purpose of improving communication amongst drivers and other related officials. The use of proper networking within the organization will improve the teamwork, reduce chances for misinterpretation which tends to be one of the biggest problems in an organization and will improvise the time performance of the new product development. All that the managers of the product development have to do is to keep the team connected to each other using various types of communication devices which are the newest e- business applications. Whether it is the technological sector, or the market side of the organization, the effective communication has always proved to create new dimensions for the organization’s products and growth. However, the effective communication allows the managers to collect ideas and apply them in their new product development which may give a measure to the innovative ideas and a speedy time performance as a result of the increased efficiency amongst the managers and the workers (Trott, 2008). The new emerging ideas also engage its managers to use the checklists as being one of the innovative factors affecting the new product development. It gives the managers a way that is simple and less time consuming, thus adding up in the reduced time performance that would eventually give way to more advantage over the competitors. The e-business applications enhance the communication amongst the organization and also enable the managers to carry out their checks through advanced communication devices using internet. This would greatly improve the way the product is established, manufactured, developed and reached out to the customers (Ulrich, 2003). There are also many key tasks and sub-activities that have to be done before the new products are developed. The emerging of advanced communication skills in the product development will enable the managers to delegate these tasks and the project objectives effectively to the workers. All the tasks and activities associated with the product development includes the communication with the external sources for example the customers. With the innovated use of e-business technologies, the organization may be able to interact more efficiently with the customers increasing the speed of development and growth. Thus, it can beheld that the use of emerging technology such as effective use of information and communication skills can enhance the new product development to reduce the time of the product development which would allow the organization to produce their product in a lesser time and gain advantage over the other competitors. The success of emerging technology in the modern world has helped many of the organizations in similar ways to improve their product development, and the growth of new products especially. References Filippini, R., Salmaso, L., Tessarolo, P. (2004). “Product Development Time Performance: Investigating the Effect of Interactions between Drivers”. Journal of Product Innovation Management 21(3), 199-214. Brown, A. (2004). Innovation Management and Contemporary Small Enterprise Research. Sydney: Edith Cowan University, Australia. The book is about the process of innovation that has become an integral and critically important activity for the businesses of present age. The author explains how the process of innovation can help the companies in attaining the maximum productivity and benefits by getting competitive edge upon their competitors. Trott, P. (2008). Innovation Management and New Product Development. London: ‎Prentice Hall. The author describes the process of new product development while focusing upon the issue of innovation that has to be attained by the companies while developing new products. The book affirms that the process of new product development could not attain the desired benefits until and unless the companies succeed to conduct proper innovation management. Ulrich, K. (2003). Product Design and Development. London: McGraw-Hill. The process of product development and design is very complicated and comprises of several important stages and process. In this book, the author has attempted to provide overview to different concepts and notions related with the product design and development that helps in gaining understanding about the importance of new product designing skills and capabilities. Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Product Development Sequence Research Paper Example | Topics and Well Written Essays - 1000 words”, n.d.)
Retrieved from https://studentshare.org/information-technology/1457339-product-development-sequence
(Product Development Sequence Research Paper Example | Topics and Well Written Essays - 1000 Words)
https://studentshare.org/information-technology/1457339-product-development-sequence.
“Product Development Sequence Research Paper Example | Topics and Well Written Essays - 1000 Words”, n.d. https://studentshare.org/information-technology/1457339-product-development-sequence.
  • Cited: 0 times

CHECK THESE SAMPLES OF Product Development Sequence

Practical Issues in Bioinformatics

Subject: Health sciences and medicine, Assignment   Topic:  Bioinformatics; CW1 – Database Coursework Date: 26th October 2012 Partial DNA sequence for a gene that your company is interested in: CGGCGCCGCGAGCTTCTCCTCTCCTCACGACCGAGGCAGAGCAGTCATTATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGG A short report telling them what data is publicly available for this gene....
6 Pages (1500 words) Assignment

The Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Technique

It was clearly demonstrated that use of right technique like PCR-RFLP makes analysis more rapid and gives good correlation between classical RFLP data and sequence based phylogenetic distance analysis.... It was clearly demonstrated that use of right technique like PCR-RFLP makes analysis more rapid and gives good correlation between classical RFLP data and sequence based phylogenetic distance analysis.... For development of PCR-RFLP based techniques mt DNA of two species were scanned in regions where COI and ATPase were located for identification of site having nucleotide sequence variations....
2 Pages (500 words) Essay

Role of Genetic Variations in Human Diseases

hellip; All these led to the development and automatization of DNA sequencing leading to generation of physical and genetic maps by the well discussed Human Genome Project (HGP).... Sufficient advances have been made to date in the area of understanding disease etiology and pathogenesis from the perspective and context of genetic variation as a driver, and with development of modern genetic laboratory technologies, it is now a reality that in the near future, there would be increasing role for genetics in the diagnosis, prevention, and treatment of complex diseases, almost all except those caused by trauma....
16 Pages (4000 words) Research Paper

Sales Force Decision Sequence

In the paper “Sales Force Decision sequence” the author analyzes three levels of sales force decision making process.... n short, sales force decision sequence starts at the top level which then transferred to the bottom level.... Customer retention and attraction process, size and structure and product & market resource development decisions are taken at the level 2.... Customer retention and attraction process, size and structure and product & market resource development decisions are taken at the level 2 whereas compensation, hiring, training, sales manager, productivity enhancement decision taken at the level 3' (Zoltners)Each level of decision making is interconnected with each other....
2 Pages (500 words) Essay

Type 2 Diabetes in a Subpopulation of Saudi Arabian Women

The most important environmental risk factor is obesity; however, this is not the only determinant of population or individual… Genetic predisposition for the disorder is also a contributing factor, and decreased susceptibility to the development of Type 2 diabetes may be correlated with certain genotypic factors.... These genes may be involved in the development of insulin resistance.... A subpopulation of Saudi Arabian women has been identified that is resistant to the development of type 2 diabetes, despite incidence rates of obesity at the same level as the entire population of women in Saudi Arabia....
4 Pages (1000 words) Essay

Fruit Content of Fruit Juice and Apple Juice Content of Cider Using DNA Methodology

The RAPD is the more fast technology that requires only very simple primers and the previous sequence information is not required for the analysis.... In the pear fruit DNA sequence, there are 15 SSR sequences and among them, 9 SSR markers were obtained from the fruit juice containing pear....
10 Pages (2500 words) Literature review

Job Opportunity in Bioinformatics

The first job opportunity that bioinformatics presents are sequence analysis.... sequence analysis was first done in 1977 when the phage Φ-X174 was sequenced.... The sequence analysts then analyze the data to find out the genes that code for proteins and other structures in the sample.... sequence analysts have, therefore, developed software that search the genome of millions of organisms, consisting of billions of nucleotides in databases (Levine 4)....
5 Pages (1250 words) Term Paper

Role of Genetic Variations in Human Diseases: Past, Present, Future

This paper explores the development and automatization of DNA sequencing leading to a generation of physical and genetic maps by the well-discussed Human Genome Project (HGP).... Sufficient advances have been made to date in the area of understanding disease etiology and pathogenesis from the perspective and context of genetic variation as a driver, and with development of modern genetic laboratory technologies, it is now a reality that in the near future, there would be increasing role for genetics in the diagnosis, prevention, and treatment of complex diseases, almost all except those caused by trauma....
16 Pages (4000 words) Research Paper
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us