Bitter Taste Perception of Phenylthiocarbamide - Research Paper Example

Bitter taste perception of phenylthiocarbamide By + The ability to taste Phenylthiocarbamide (PTC), a bitter organic compound, described as a bimodal autosomal trait is widely used to know the heritable trait in both genetic and anthropological studies. The present study was carried out to analyse the prevalence of PTC taste sensitivity and to determine the gene frequencies in individual. This study has some physiological relevance to highlight the adaptability of an individual. The capability to taste the bitter composite phenylthiocarbamide (PTC) and associated chemicals is bimodal, and all that have been tested to date contain some people who can and other people who cannot taste PTC. The reason for maintenance of this trait in the population is uncertain but this polymorphism may influence food selection, nutritional status or thyroid metabolism. The gene product that gives rise to this phenotype is unknown, and its characterization would provide insight into the mechanism of bitter taste perception. Although this trait is often considered a simple Mendelian trait in which one gene two alleles, a recent linkage study found a major locus on chromosome 5p15 and evidence for an additional locus on chromosome 7. The development of methods to identify these genes will provide a good way to understand between single-gene disorders and polygenic trait. Introduction Understanding single-gene disorder and polygenic trait is important for taste perception. The two major forms differ from each other at three amino acid positions, and both alleles have been maintained at high frequency by balancing natural selection, suggesting that the non-taster allele serves some function (Kho et al., 2005). In the experiment, there was hypothesis that this function is to serve as a receptor for another, as yet unidentified toxic bitter substance. At least some of the remaining five haplotypes appear to confer intermediate sensitivity to PTC, suggesting future detailed studies of the relationships between receptor structure and taste function. Sensitivity to bitterness among individuals and groups of different ethnicity differ due to polymorphic bitter taste receptors (Kho et al., 2005). PTC/PROP bitter taste receptiveness at locus TAS2R38 is a well-established guide of individual alteration in oral sensation that has been related to predicting food taste and consumption (Hauxwell, 2013). Previous studies suggest that the relationship between PTC/PROP and anthropometric characters remains debated. Standing by his side colleague complained about the bitter taste, while Dr. Fox, who was closer and should have uptake a strong dose, tasted nothing. Fox then continued to test the taste buds of assorted family and friends. In this way, Fox got concerned with differences that occurred in tastes hence setting the groundwork for future genetic investigations. The genetic correlation was so evident that it was used in paternity tests before the advent of DNA matching. Phenylthiocarbamide, also known as PTC, or phenylthiourea, is an organic compound that either tastes very bitter, or is virtually tasteless, depending on the genetic makeup of the taster (Hauxwell, 2013). The ability to taste PTC is a dominant genetic trait. The test to determine PTC sensitivity is one of the most common genetic tests on humans. There are three SNPs along the gene that may render its proteins unresponsive. Any person with a single functional copy of this gene can make the protein and is sensitive to PTC. Some studies have shown that homozygous tasters experience a more intense bitterness than people who are heterozygous; other studies have indicated that another gene may determine taste sensitivity. TAS2R38 locus seems to have a role in food tastes, choices and preferences. Perceived bitterness of PTC/PROP thresholds were significantly and negatively correlated with body height and fat-free mass. Methods The methods used in the experiment are those which matches individual’s phenotype. In the experiment, a wooden splint was used to scrape inside the cheeks to remove loose cheek cells. After the cheek cells were removed, a sterile plastic loop is used to scrape all of the cheek cells off the wooden splint. The loop is then twirled into an eppendorf tube of 1.5 ml containing 350 μl 5% Chelex suspensions. In the apparatus, add 4 μl of Proteinase K to the cheek cells and chelex. The solution is then incubated at 56 degree Celsius for a period of 30 minutes. The tube is then briefly vortex for 20 seconds. Centrifuge tube at maximum (13,000 rpm) speed for 20 seconds, ensuring centrifuge is balanced. Place tube containing Chelex/cells in a water bath/heating block at 98˚C for 15 minutes. Vortex tube for 10 seconds and then centrifuge tube at maximum speed for 3 minutes. Transfer supernatant (liquid above the chelex), containing cheek cell DNA (Template), to a sterile 1.5 ml Eppendorf tube. Take an aliquot (5 µl) of your sample and take the aliquot to be measured using the nanodrop nucleic acid measurement machine retain concentration (ng/ µl; A260, A280, 260/280, 260/230) for reference. Residual DNA will be retained (frozen) for the PCR reaction which will be undertaken next week. Uniquely label your eppendorf and indicate on the template your positional place on ice/eppendorf tray to preserve DNA to complete the practical (PCR) next week. In the following week of experiment, each student will be provided with a micro-eppendorf tube with which you will assemble your PCR reaction. The master mix contains all of the PCR reaction components permitting detection of your PTC gene. However, it does not contain the template DNA. In carrying out experiment on the already made mixture, add the following to one tube 6.5 l Master mix (already prepared) 6.5 l Template DNA preps. (Buccal cell DNA) (Total volume = 50 l) Mix to dissolve (flicking with a finger), then pulse spin to gather the liquid contents to the bottom of the tube. Place tube in template for thermal cycler, ensuring that your lid is securely on, and note position of tube on matrix sheet and run using the following programme: 94˚C 4 minutes 55˚C 40 seconds 72˚C 40 seconds 40 cycles 94˚C 40 seconds 55˚C 5 minutes 72˚C 5 minutes Access your PCR tube carefully (see template for ID), trying not to disturb the other students’ PCR tubes. Retrieve your PCR tube and go to an area on the bench where you will remove an aliquot (20 µl) from your PCR tube and add it to a 0.5 ml eppendorf tube already containing 10 µl of Fnu4HI restriction enzyme master mix (total now 30 µl). Mix tube contents by flicking with finger, centrifuge briefly and place in 37°C heating block/water bath. Uniquely mark on tube/heating block/water bath template where your Fnu4HI digested PCR tube is located. Return your last week’s PCR tube to its original position in the container (you will be resolving both your digested AND undigested PCR products in this afternoon’s practical). Leave quietly and considerately for those individuals who are; undertaking the assay and who will undertake the digest, following your group’s time-slot. The Fnu4HI restriction enzyme digest will require a minimum of 2hrs. there is then requirement of Setup 2% submerged agarose gel; Geneflow tanks (PurpleLids, 12 well comb) require 70 ml, Peqlab / Hybaid tanks (10 well comb) require 50ml agarose, and leave to set. Add 3 µl of DNA loading buffer (x5) to a tube containing 12 µl PCR/R Enzyme digest. This is mainly done in the morning. Add 3 µl of DNA loading buffer (x5) to a tube containing 12 µl residual PCR. This is done to the mixture which was obtained from the previous week. Mix (finger) and pulse spin both tubes (total 15 µl) and add 8 – 10 µl of this mixture to a 2% agarose gel submerged in TBE buffer noting the lanes you have loaded (UD & Digested). Add 8-10 µl of 100 bp DNA Ladder to remaining well as a DNA marker Electrophoresis at 90 V for 45min until blue marker is halfway through gel (write-up requirements will be discussed here) Photograph gel under UV trans illumination. Dispose of Ethidium Bromide & Agarose gel responsibly in the available designated container DNA primer pairs; PTC Forward 1 AACTGGCAGAATAAAGATCTCAATTTAT PTC Reverse 2 AACACAAACCATCACCCCTATTTT Results Distance travelled (mm) Ladder fragment (Log) 11 3 12 2.954242509 13 2.903089987 14 2.84509804 16 2.77815125 18 2.698970004 20 2.602059991 23 2.477121255 27 2.301029996 32 2 Fig.2. Representative Graph plotted from the data obtained from the Log (MWT) against distance travelled by the ladder fragments (data are on table). Calculation: From the graph the equation is y = -0.0458x + 3.5083 In which Y= Molecular Weight fragment, X= Travelled Distance Unknown MW of undigested DNA as measured by ruler ( 23 mm) y = -0.0458x + 3.5083 y = -0.0458(23) + 3.5083 y = -1.0534 + 3.5083 y = 2.4549 y = anti log 2.4549 y= 285.036 Unknown MW of Digested DNA as measured by ruler ( 25 mm) y = -0.0458x + 3.5083 y = -0.0458(25) + 3.5083 y = -1.145+ 3.5083 y = 2.3633 y = anti log 2.3633 Table 2: Allele frequency of student’s class Allele type C T Number (216) 93 123 Allele frequency 0.430 (43%) 0.569 (57%) Table 3 the percentage and the frequency of 226 persons who are either a homozygous or heterozygous (European cohort) Genotype taster genotype (CC) mild tasters (CT) non tasters (TT) Number of persons 44 106 76 Frequency 0.195 0.469 0.336 Frequency as percentage 20 50 30 Table 4: Allele frequency of European people Allele type T C Number (452) 258 194 Allele frequency 0.571 0.429 Table 5 shows the percentage and the frequency of 224 persons who are either a homozygous or heterozygous (sub-Sahara cohort) Table 6: Allele frequency of sub-Sahara people Allele type C T Number (448) 306 142 Allele frequency 0.683 (68.3%) 0.317 (31.7%) Chi Square from Mini tab: Student Vs European Rows: Worksheet rows Columns: Worksheet columns C785 T785 All 1 93 123 216 92.8 123. 2 194 258 452 194.2 257. All 287 381 668 Cell Contents: Count Expected count Pearson Chi-Square = 0.001; DF = 1; P-Value = 0.974 Likelihood Ratio Chi-Square = 0.001; DF = 1; P-Value = 0.974 Student Vs Sub Saharaian Africa Rows: Worksheet rows Columns: Worksheet columns 1 C785 T785 All 93 123 216 129.8 86.2 2 306 142 448 269.2 178.8 All 399 265 664 Cell Contents: Count Expected count Pearson Chi-Square = 38.738; DF = 1; P-Value = 0.000 Likelihood Ratio Chi-Square = 38.405; DF = 1; P-Value = 0.000 Non taster: LOCUS AY258598 1002 bp DNA linear PRI 29-APR-2003 DEFINITION Homo sapiens PTC bitter taste receptor (PTC) gene, PTC-non-taster allele, complete cds. ACCESSION AY258598 VERSION AY258598.1 GI:30230490 1 atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc 61 atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat 121 ttttgggatg tagtgaagag gcaggcactg agcaacagtg attgtgtgct gctgtgtctc 181 agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac 241 ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg 301 attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag 361 ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc 421 tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg 481 tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca 541 aggctcaact ggcagattaa agatctcaat ttattttatt cctttctctt ctgctatctg 601 tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg 661 ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag 721 gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc 781 tgtgttgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg 841 gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccatcct gatctcaggc 901 aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag 961 gtaagagccg accacaaggc agattcccgg acactgtgct ga Red= SNP Yellow= Forward Primer Green= Reverse primer Taster: LOCUS AY258597 1002 bp DNA linear PRI 29-APR-2003 DEFINITION Homo sapiens PTC bitter taste receptor (PTC) gene, PTC-taster allele, complete cds. ACCESSION AY258597 VERSION AY258597.1 GI:30230488 1 atgttgactc taactcgcat ccgcactgtg tcctatgaag tcaggagtac atttctgttc 61 atttcagtcc tggagtttgc agtggggttt ctgaccaatg ccttcgtttt cttggtgaat 121 ttttgggatg tagtgaagag gcagccactg agcaacagtg attgtgtgct gctgtgtctc 181 agcatcagcc ggcttttcct gcatggactg ctgttcctga gtgctatcca gcttacccac 241 ttccagaagt tgagtgaacc actgaaccac agctaccaag ccatcatcat gctatggatg 301 attgcaaacc aagccaacct ctggcttgct gcctgcctca gcctgcttta ctgctccaag 361 ctcatccgtt tctctcacac cttcctgatc tgcttggcaa gctgggtctc caggaagatc 421 tcccagatgc tcctgggtat tattctttgc tcctgcatct gcactgtcct ctgtgtttgg 481 tgctttttta gcagacctca cttcacagtc acaactgtgc tattcatgaa taacaataca 541 aggctcaact ggcagattaa agatctcaat ttattttatt cctttctctt ctgctatctg 601 tggtctgtgc ctcctttcct attgtttctg gtttcttctg ggatgctgac tgtctccctg 661 ggaaggcaca tgaggacaat gaaggtctat accagaaact ctcgtgaccc cagcctggag 721 gcccacatta aagccctcaa gtctcttgtc tcctttttct gcttctttgt gatatcatcc 781 tgtgctgcct tcatctctgt gcccctactg attctgtggc gcgacaaaat aggggtgatg 841 gtttgtgttg ggataatggc agcttgtccc tctgggcatg cagccgtcct gatctcaggc 901 aatgccaagt tgaggagagc tgtgatgacc attctgctct gggctcagag cagcctgaag 961 gtaagagccg accacaaggc agattcccgg acactgtgct ga Discussion In the experiment, when a standard curve of log molecular weight was plotted against distance travelled from well in millimetres, it produces a straight line graph sloping to the left. From the graph, the calculations done shows that unknown molecular weight of undigested DNA brought out log molecular weight of 285.036. This is when it was measured in 23mm. when measured in 25mm, the result indicates 230.834. It brings a difference of 54.526. In the case of genotype of determining tester genotype, mild tasters and non-tasters, it was found that a higher number are mild testers with a percentage of 47, tester genotype with a percentage of 33 then tester genotype with 20 %. Allele frequency of non-testers in the class were higher those of mild-testers as out of 216 students, 123 of the class were non-testers. Percentage and frequency of 226 who are either homozygous or heterozygous showed that tester genotype (CC) had a total of 44 people with percentage frequency of 20. Genotype of mild tasters (CT) was 106 by number with a percentage of 50 and genotype of non-testers (TT) being 76 with a percentage of 30. This shows that most of the students were found to be mild testers. For students vs. European analysis, results from the chi-square are 0.001 with DF value of 1 and p-value of 0.974. This is due to the expected counts and all the counts that were obtained. The result was similar to the likelihood ratio chi-square. Most Europeans as brought out by the chi-square are mild tasters with the students most being non-testers. Chi-square analysis was also carried out in students vs. Saharaian Africa where person chi-square was found to be 38.738, DF being 1 and p-value of 0. Likelihood ratio chi-square being 38.405, DF value and p-value of 0. The test to determine PTC sensitivity is one of the most common genetic tests on humans. There are three SNPs along the gene that may render its proteins unresponsive. Purification of DNA is the first important point to be mentioned is the reason why exactly cheek cells were used in the experiment. The reason for the use is very simple and evident as the cells are easy to collect and homogeneous collection of cells may be obtained, meaning purer cells (Hauxwell, 2013). The cells are pure and available when they are still alive. Cell Mysis Solution as it can be understood from the name of the compound was used in order to disrupt cell membranes in order to form crude extract, and temperature was increased to 65 C to speed the rate of breaking down of the cellular membrane components. RNase solution was used in order to stop transcription of RNA from DNA. One can ask why we should stop the transcription (Freedman, 2007). Answer to this question is based on the fact that if someone does need to purify DNA as a result of the experiment, the presence of RNA will contaminate the DNA solution that will lead to improper qualification and quantification of the sample in the following procedures. Proteinase K and glycogen solutions were used in the procedure in order to wash DNA and make it sink as glycogen binds to DNA, making it easier to isolate DNA from the sample as the result of centrifugation. Proteinase K was used for two reasons mentioned previously but for more accuracy: washing and precipitation of DNA. Finally in the section A DNA hydration solution was added to DNA in order to keep it moisture and usable for the following steps in PCR. Receptor proteins recognize bitter-tasting compounds on the surface of taste cells. There are approximately 30 genes for different bitter taste receptors. The gene for the PTC taste receptor, TAS2R38, was identified in 2003. Sequencing identified three nucleotide positions that vary within the human population (Freedman, 2007); each variable position is termed a single nucleotide polymorphism (SNP). One specific combination of the three SNPs, termed a haplotype, correlates most strongly with tasting ability. In this lab, non-tasters (homozygous recessive, tt) can determine their genotype without having to run the PCR and electrophoresis because non-taster gene is recessive (Freedman, 2007). Thus, the only way for them to express recessive phenotype is to have the tt alleles of the gene. However, it is not the same case for tasters because we can be either Tt or TT. This is a very interesting lab. The PTC gene itself is particularly noteworthy. Researchers suggested that the gene is strongly correlated to natural selection and defence mechanism in plants. Bitter compounds similar to PTC have been found in a wide variety of plants, the bitter toxins discouraged herbivores and other threads from violating the plant. Recent researchers also found that there is variation in PTC gene haplotypes, beside the two common alleles. This is contradictory to the notion that the PTC gene is a perfect example for a Mendelian trait. Bitter and sweet tastes are facilitated by G-protein-coupled receptors. Bitter taste receptors are determined by 25-30 TAS2R genes, situated on chromosomes 12p13, 7q34, and 5p15. The ligand selectivity of TAS2Rs seems to be quite wide, reliable with their roles in sensing thousands of bitter-tasting composites (Chen, Sternini and Rozengurt, 2008). One of these, TAS2R38 has been extensively characterized in vitro, in vivo, and in human populations, and is responsive to the bitter stimuli. Propylthiouracil (PROP), phenylthiocarbamide, and to thiocyanates bitter compounds found in brassica vegetables such as broccoli and Brussels sprouts. Particular nucleotide polymorphisms (SNP) situated within a connection disequilibrium block of these genes responsible for the association of taste, food favourite and surge in weight. Previous studies reveal a high incidence of non-tasters among patients with nodular goitre congenital athyreotic, cretinism and dental caries. Several studies showed that people who can taste PTC (taster) are more sensitive to salt, sweet foods, sharp tasting foods, spicy foods, and alcohol. Tasters are also better in discriminating between high and low fat foods, such as various types of salad etc. Anatomical studies reported that tasters actually have more taste buds than non-tasters (Chen, Sternini and Rozengurt, 2008). In the study, it can be reported that non tasters like high fat diet more, than low fat diet, whereas tasters shows the lack of preference for food. The results of the research also reported that the taste of sucrose is more intensively sweet to tasters than to non-tasters and tasters have high sensitivity to sweetener such as saccharin and neohesperidin dihydrochalone. Food pattern and eating habits of the children involves the information of the type of diet, frequency of non-vegetarian consumption, nature of food, frequency of consumption of stuff food, nutrient intake and other factors (Chen, Sternini and Rozengurt, 2008). The study found more non tasters who are overweight/obese compare to taster, which once again emphasizes on the choice of food and its relation with obesity in general population When the PTC taster and non-taster were subjected for logistic regression analysis the effect of childhood obesity was not diluted showing an increase in odds by 18% and 29% per extra year in tasters and non-tasters respectively. The statistically significant variation also holds good for consumption of balance diet, high caloric diet and physical exercise in African children and controls. This results supports that, sensation in choice of food is very much diminished in non-tasters. Tasting ability is also likely to be influenced by many other sensory and proprioceptive pathways, and the probable result is that no single genetic marker has a great effect. In particular, other pathways are likely to include olfactory contributions to food preference, although digestive and cognitive factors may complicate the overall system and modify the ability to perceive bitter taste. The present study shows that overweight and those is Africa, children was less likely to consume food like wheat, vegetable and fruits in their daily food which are highly nutritive whereas high consumption of bakery product, junk food, meat, chicken, fat and oily food in their diet was evident (Caicedo, 2001). As majority of overweight children being non-sensitive to salt, sweet foods, sharp tasting foods, spicy foods and high fat diet they consume more bakery products, junk food and typically incorporate all of the potentially adverse dietary factors in a large portion size (Caicedo, 2001). TAS2R38 locus seems to have a role in food tastes, choices and preferences. Perceived bitterness of PTC/PROP thresholds were significantly and negatively correlated with body height and fat-free mass (Barnes and Rose, 2002). These results, thus, tentatively suggest that the PTC non-taster gene may help in better absorption of calcium than its counter taster allele. Studies on differences in calcium metabolism between PTC tasters and non-tasters are needed to confirm these indications across cultures. A mechanism that helps to better examine a specific region of the TAS2R38 gene is called cleaving. This is done by restriction enzymes named restriction endonucleases that “chop” DNA at a certain region of a gene. One restriction endonuclease, called HaeIII, reads and cuts the DNA depending upon what nucleotide sequence is present at location 145 in the amplified 220 bp TAS2R38 gene region (Barnes and Rose, 2002). Once the desired nucleotide sequence is recognized at this position (GGCG), this enzyme will clip the DNA at that region since there is a restriction site present at this allele, and will not clip if the DNA sequence is read as GGGG since there is no restriction site for “G” allele for HaeIII. This means that the PTC non tasting allele is recessive (t) and the PTC tasting allele is dominant (Caicedo, 2001). References Barnes, D. and Rose, P. (2002). Matters of taste. Albany, N.Y.: Syracuse University Press. BozÌŒić-Krstić, V., Savić, M. and Stajić, N. (1991). Taste sensitivity to phenylthiocarbamide (PTC) in the school children of Titov Vrbas and NiksÌŒić. Caicedo, A. (2001). Taste Receptor Cells That Discriminate Between Bitter Stimuli. Science, 291(5508), pp.1557-1560. Carmichael, H. (1997). A slightly bitter taste. Leicester: Linford. Chen, M., Sternini, C. and Rozengurt, E. (2008). S1658 Bitter Taste Receptor Agonists Denatonium Benzoate (DB) and Phenylthiocarbamide (PTC) Activate ERK Pathway Through Different Mechanisms in Enteroendocrine STC-1 Cells. Gastroenterology, 134(4), pp.A-243-A-244. Coulter, M. (1998). Ability of students in food and nutrition related fields to perceive phenylthiocarbamide (PTC) Evans, D. (2010). Bitter taste. AuthorHouse. Freedman, P. (2007). Food. Berkeley: University of California Press. Gonzalez, B. (2008). The bitter taste of time. New York: Thomas Dunne Books/St. Martins Griffin. Hauxwell, A. (2013). A bitter taste. Melbourne: Penguin Books. Hernandez, T. (n.d.). Obsession 3. Igbeneghu, C. (2014). Association between Phenylthiocarbamide (PTC) Taste Perception and Falciparum Malaria Infection in Osogbo, Southwestern Nigeria. ARRB, 4(14), pp.2295-2301. Kho, H., Chang, W., Lee, J., Chung, J., Kim, Y. and Chung, S. (2005). The relationship between phenylthiocarbamide/n-6-propylthiouracil (PTC/PROP) taste perception and taste thresholds for sucrose and quinine. Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontology, 99(4), p.426. Kim, U. and Drayna, D. (2004). Genetics of individual differences in bitter taste perception: lessons from the PTC gene. Clinical Genetics, 67(4), pp.275-280. Morris, K. (2005). Bitter taste of rhetoric. The Lancet, 365(9468), p.1380. Moss, M. (2013). Salt, sugar, fat. New York: Random House. Nabb, M. (2002). Some bitter taste. New York: Soho Press. Prescott, J. and Tepper, B. (2004). Genetic variation in taste sensitivity. New York: Marcel Dekker, Inc. Tanaka, T. (2007). Bitter taste and diet. Vooght, D. (2011). Royal taste. Farnham, England: Ashgate. Wilkie, L. (2012). Individual differences in taste perception and bitterness masking. Woodward, K. (2005). Taste. Milwaukee, WI: Gareth Stevens Pub. Read More