The Apolipoprotein A-II gene promoter about Chronic Diseases - Research Paper Example

APOA2 IN RELATION TO CHRONIC DISEASES By Presented to 12.6% of required total energy and obesity risk attached to FTO rs9939609 SNP (Moleres et al. 2012, Corella , 2011, Frayling et al., 2007). Another crucial role played by FTO gene is energy intake control. In a study that involved UK children possessing the rs9939609 A allele took foods that were more energy-dense than those without the allele implying that the FTO intronic SNP rs9939609 that is obesity linked is associated with satiety responsiveness that is impaired (Wardle et al., 2008). Melanocortin 4-receptor (MC4R) gene accounts for the majority of the common childhood and adult forms of obesity. There are currently, more than 150 diverse mutations of heterozygous and homozygous MC4R reported in obese persons with diverse ethnic backgrounds (Tao et al. 2009). In a previous gene candidate approach, SNP on the V103I and I251L variants indicated that persons with the 103I carriers possess a 21% reduction in risk for obesity (Wang et al., 2010). On the other hand, 251 L-allele carriers have an approximately 50% reduction in obesity risk (Loos, 2011). GWAS studies on SNPs near- MC4R locus showed significant linkage with BMI, the rate of obesity and waist circumference. For example adult, SNP near locus-MC4R showed a BMI increase of approximately 0.10–30 kg/m2 and circumference of their waists by approximately 0.40–0.70 cm (Loos et al., 2011). APOA2 Although early studies done have reported there being an inverse relationship CVD risk and plasma APOA (Fager et al, 1981; Buring et al, 1992), findings revealed from subsequent studies showed no significant associations, neither did they suggest any proatherogenic role (Ridker et al, 2005; Tailleux et al, 2002;Escola, 1998). Overexpression of APOA2 in mice revealed increased of streak aortic fatty lesions (Warden et al., 1993; Schultz et al., 1992) There are major variances between human and murine APOA2, however, the human APOA2 overexpression in mice has different effects to those of APOA2 murine on atherosclerosis (Castellani et al., 1997; Scott et al., 1985). There have been few studies examining the association between phenotypic traits (Ferns et al., 196; Vohl et al.,1997; Martin et al., 2004;). In addition, few variants of the gene have been revealed in the APOA2 gene (Fullerton et al., 2002). Interestingly, there has been reported a T>C transition at -265 position (rs no. 5082) that affects APOA2 promoter element D to be functional in two separate and independent studies which both demonstrated a basal transcription activity drop of a ∼30% (Van’t et al. 2001; Takada et al.,2002 ). In one study, the polymorphism of −265T>C was associated with men’s waist circumference (Van’t et al. 2001). Another study (Lara et al, 2005)) showed an association between the same polymorphism and women’s fat depots in the abdomen Although Castellani et al. ( 2001) found an increase in a mouses body weight overexpressing APOA2, the process by which APOA2 could affect body weight remains largely unknown. APOA2 is belonging to a family of apolipoprotein mitigation that is inclusive of genes that encode soluble apolipoproteins (such as APOA1 and APOA4) and which share several functions and genomic structure. Although their apolipoprotein superfamily are related to obesity in different epidemiological study (Rankinen et al. 2005), it is only the APOA4 that is subscribed in food intake regulation acting as a signal for satiety (Tso et al 2004). 2.0 Methodology Isolation and purification of DNA template: Cells (10 x 106) were twice washed with PBS and pallet at 100g for 5 minutes and were resuspended in 1ml of NTE(100mM NaCl, 10mM Tria pH 7.5, 1mM EDTA). Proteinase K/NTE (1mg/ml proteinase K in NTE solution) was pre-warmed for 15 minutes at 37oC, and 100 µl cell suspension was added. Sodium dodecyl sulphate (SDS) was added to a final concentration of 0.5% w/v and incubated in a water bath at 37oC overnight. One volume of phenol (previously saturated with NTE, pH8.5) was added to the tube, and the whole mix was centrifuged at room temperature for ten minutes at 5000rpm. The upper phase was removed into a new microcentrifuge tube. One volume of chloroform: isoamyl alcohol (24:1) was added and centrifuged for 10 minutes at 5000rpm. Phenol and chloroform: isoamyl steps were repeated until no material remained at the Interphase (x4). Upper phase, then was removed, and a 3M sodium acetate + 2 volumes of 100%ice cold ethanol were added. Finally, the mix was centrifuged for 10 minutes at 3000rpm to pellet the DNA was left to dry and resuspended in 50µl TE buffer (10 mMTris, 1mM EDTA). Optimizing annealing temperature (temperature gradient): I. Sample preparation A master mix (400 µl) was made by adding 360 µl of supermix (invetrogen PCR supermix), 8 µl of APOA2 reverse primer, 8 µl of APOA2 Forward primer, 8 µl of DNA template (THP-1) and 8 of µl Molecular H2o. The master mix was divided into 8 PCR tubes in which each contained 50 µl. II. DNA amplification The 8 samples were inserted into the thermal cycler for amplification (two Hours) and temperature were set between 50o-60o C on the following order: Tube No. 1 2 3 4 5 6 7 8 Temperature 60 59.4 58.3 56.3 53.9 52.0 50.7 50 On the second run the temperature was readjusted as follows: Tube No. 1 2 3 4 5 6 7 8 Temperature 56.0 56.6 58.0 56.3 53.9 52.0 50.7 50 III. Gel Preparation: 2% Agarose gel was made by adding 0.6 of Agarose to a 30 ml of TBE Buffer. The mix was microwaved to a boiling point, left to cool down for a couple of minutes and then poured into the gel tank with a 12 wells comb. On the second run, two gels were made by adding 0.8 g of Agarose to 40 ml of TBE buffer and poured into eight wells comb to observe more product. IV. Running the gel and visualization: On the first run, 6 µl of each amplified tube were collected and mixed with 2 µl of loading buffer and inserted into the wells. A 100 bp Ladder (6 µl) was placed on the first well for molecular weight observation. On the second run, 10 µl of loading buffer was added to each of the amplified products (containing 50 µl) where 23 µl was collected from each tube to be inserted into the 8 wells into gels. In both run, the time was set for 60 minutes and then stained with ethidium bromide and destined with deionised water while placing on an orbital mixer. Finally, an image was obtained by placing the gel on the U/V Trans-illuminator chamber of the Gel doc. Amplifying different cell lines for DNA purification The same principles (sample preparation, DNA amplification, gel preparation and Running the gel + visualization) have been used, however there were a couple of adjustments, including the use of six different cell lines (Hacat, THP-1, Hela, Caski, Hecv and MM6) each in a different tube. Two gels were made for gel purification, each containing 8 wells where the product was mixed with 10 µl of loading buffer and was inserted into two wells in which each contained 23 µl. DNA purification from the gel: I. Dissolving the gel and Binding of DNA. DNA bands were sliced using a razor blade and placed in a 1.5ml Microcentrifuge. For each 10mg of the gel slice, 10 µl of Membrane Binding Solution was added as follows: Cell line THP1 MM6 Hela Hacat Hecv Caski Slice weight 866mg 941mg 10051mg 10551mg 866mg 687mg MBS volume 87 µl 94 µl 101 µl 106 µl 87 µl 69 µl As the gel slices were large to be dissolved with the MBS, the gel was first dissolved by placing it in a water bath at 50/65 Co and then centrifuged at 16,00 x g for 1 minutes to a couple of runs using the same SV minicolumn (dissolved gel + equal amount of MBS) for each dissolved the gel band. Following this, the flow through was discarded, and the minicolumn was reinserted into the collection tube. II. Washing and elution: The washing process was done by adding 700 µl Membrane wash solution (ethanol added) and centrifuged at 16,000 x g for 5 minutes. Again, the flow through was discarded, and the minicolumn was reinserted into the collection tube. Washing step was repeated with the addition of 500 µl of the Membrane washing solution. After the disposal of flow through the sample was centrifuged with its lid open to allow evaporation of any residual ethanol. Finally, the minicolumn was transferred to a clean 1.5ml centrifuge tube and 50 µl of Nuclease-free water, incubated for 1 minute at room temperature and centrifuged at 16,000 x g for 1 minute. In the end, 50µl of purified DNA was obtained from each amplified tube. One µl of each tube was used to measure the DNA concentration using NanoDrop, and the rest were sent to Cardiff University for sequencing. DNA Purification from the tube: Amplified products of this session had a different supermix that was made by the staff: Reagent Per 50 µl reactions 10x Buffer 5.00 µl dNTP ( 2500 mM each stock-220 mM) 4.40 µl MgCl2 (50 mM stock -1.65 mM) 1.65 µl Taq (5 unit//pl) 0.22 µl Molecular H2o 33.73 µl The purification started by adding an equal volume of MBS to each of the PCR product (50 µl) and the rest of the steps were done the same as the purification from the gel slice; Washing  elution. After obtaining the pure DNA, (50 µl each tube), a gel of 12 wells containing ten µl from each pure DNA was run for verification and Primers dimmers absence. Also, a one µl of the pure DNA was used to measure the concentration using NanoDrop. 3.0 Results Figure 1.1 Gel image of the first optimization of annealing temperature where it seems that the annealing temperature might be above the highest temperature (60Co). Figure 1.2 Gel image of the second attempt of obtaining the annealing temperature where 62.3Co is confirmed as the most accurate. Figure 1.3 showing only two cell lines were amplified (Caski and Hela). Both were sliced and stored in the freezer. Figure 1.4 showing 5 cell lines were amplified (Hela, Hacat, Hecv, MM6, and THP-1). Hecv’s well indicates a high concentration of DNA template. Primer dimers can be seen in all cell line indicating a probable miscalculation of the combination volume. Purified Product DNA Yield after purification (ng/ µl) THP-1 (from Figure 1.4) 3.9 MM6 (from Figure 1.4) 4.9 Hela (from Figure 1.4) 3.9 Hacat (from Figure 1.4) 3.4 Hecv (from Figure 1.4) 6.3 Caski(from Figure 1.3) 4.4 Table 1.1 shows the concentration of pure DNA products (from the gel) by using NanoDrop. It can be seen that the concentration is relatively low as a result of an error in slicing the gel that resulted in large pieces and also unbalanced reagent combination. Purified Product DNA Yield after purification (ng/ µl) 260/280 260/230 THP-1 51.8 1.81 1.92 MM6 41.6 1.82 1.79 Hela 40.0 1.84 1.77 Hacat 41.6 1.84 1.86 Hecv 40.6 1.81 1.97 Caski 81.1 1.84 1.91 Table 1.2 shows the concentration of pure DNA products (from direct PCR amplification) by using NanoDrop. According to the manual of NanoDrop, ~1.80 on the 260/280 is regarded as a pure DNA. Figure 1.5 shows gel image of pure DNA that was purified directly from the tube. It is worth noting that THP and MM6 had no primer dimers that gave them more potential in sequencing. Sequencing Results: THP-1 LOCUS       6-APOA2_013_G09       248 bp    DNA     linear   UNA  FEATURES             Location/Qualifiers ORIGIN AAGCATTCTCGTACTTGGATCTGCTTCTGTTGCATTCAAGTCCAAGGACCTCAGATCTCAAAAGAATGAACCTCAAATATACCTGAAGTGTACCCCCTTAGCCTCCACTAAGAGCTGTACCCCCTGCCTCTCACCCCATCACCATGAGTCTTCCATGTGCTTGTCCTCTCCTCCCCCATTTCTCCAACTTGTTTATCCTCACATAATCCCTGCCCCACTGGGCCCATCCA TAGTCCCTGT CACCTGAA Red= SNP location according to data obtained from Blast. MM6 LOCUS       7-APOA2_015_H09       246 bp    DNA     linear   UNA  FEATURES             Location/Qualifiers ORIGIN CCTCAATCAGCGTACCTGTATCTGCTTCTGTTGCATTCAGTCCAAGGACCTCAGATCTCAAAAGAATGAACCTCAAATATACCTGAAGTGTACCCCCTTAGCCTCCACTAAGAGCTGTACCCCCTGCCTCTCACCCCATCACCATGAGTCTTCCATGTGCTTGTCCTCTCCTCCCCCATTTCTCCAACTTGTTTATCCTCACATAATCCCTGCCCCACTGGGCCCATCCATAGTCCCTGTCACCTG . 4.0 Discussion In the process of polymerase chain reaction (PCR) technique, amplification of DNA in vitro is done through a number of polymerization cycles that include three steps that are temperature-dependent: DNA denaturation, annealing of primers-template, and synthesis of DNA by a DNA polymerase that is thermostable. The yield and purity of the reaction products are dependent on several parameters, and one such parameter is the annealing temperature (Ta). In Ta values that are sub- and super-optimal, formation of non-specific products can occur and thus lead to reduced yield of products. Optimization of the Ta is critical, especially during synthesis of long products or when the substrate for PCR is the total genomic DNA. In the first attempt, the image produced showed that the temperature required for annealing was above 60 degrees as no bands were formed, a repeat process was necessitated where temperatures above the 60 degree mark would be used. The second attempt indicated that the optimum annealing temperature was at 62.3 degrees. The gel percentage has an effect on DNA migration where the higher the concentration of the gel, the slower the DNA migration rate through the gel. Additionally, molecular weight plays an important role in the DNA migration sample or marker, the higher the DNA molecular weight, the more slowly it will migrate. Gel concentration impacts on the visibility of bands that are run on the gel where smaller bands are better resolved on the gel of higher percentage and high molecular weight bands are better viewed on low gel percentage. The first process showed that only two cell lines were amplified (Caski and Hela) which were sliced and stored in the freezer. The second process yielded 5 cell lines (Hela, Hacat, Hecv, MM6, and THP-1). Hecv’s well indicated high concentration of DNA template. Primer dimers were observed in all cell lines indicating a probable miscalculation of the combined volume. The process was repeated using purified DNA for the six cell lines, and it was noted that THP and MM6 had no primer dimers that gave them more potential in sequencing. THP1 are monocytic human cell lines that are derived from a patient with acute monocytic leukemia. They are used immunocytochemical analysis in testing, leukemia cell lines for protein-protein interaction, as well as in immunohistochemistry. The Mono Mac 6 (MM6) cell lines are the only ones that appear to express constitutively functional and phenotypic features of mature monocytes hence relevant in this study. They have been used in studies involving cancer research as well as other chronic diseases (Ziegler, 1998). APOA-II is a major apolipoprotein that is found in the plasma in two forms; one form creates dimers comprising 77 amino acids and the other links to the HDL surface through a B-Octyl glucoside molecule thus accounts for approximately 20% of its protein content (Martin et al.,2004). Apo A-II has been studied widely in mice and has been found to influence key enzyme regulation, including cholesterol ester transfer protein, lecithin-cholesterol acyltransferase, hepatic lipase and phospholipid transfer protein. In addition, the APOA2 gene promoter -265T/C 65T>C SNP could be associated with insulin resistance (IR) and obesity. This SNP was studied by Van t Hooft et al.(2001) based on its location in the regulatory element D of the Apo promoter region where nuclear factors are bound. The study revealed that the minor allele -265T/C SNP presently reduced the production of APOA2 and also resulted in the reduction of postprandial metabolism in a sample population comprising of middle-aged men. Specifically, the study showed that subjects who were homozygous for the C allele had the concentration of the apoB-100 that was lower for large TRL 6 h following an oral fat load compared to homozygous subjects who were homozygous for the common T allele. It was also noted in that study that TG, as well as other postprandial particles, including chrylomicron or APO B-48 remnants, were not affected by the SNP. From the gel electrophoresis done in this study of the THP1 and MM6, it can be seen that the allele -265 T/C is present in MM6 cell line and not in the T/T THP1 cell line. Based on the vant Hooft results, it can be assumed that the MM6 cell line will have a reduction in APOA2 promoter and subsequent reduction in fat metabolism. The sample carrier is then assumed to be at high risk of being obese due to decreased cell metabolic activity. Further, there have been establishment of a relationship levels of APOA2 and TG in families with high rate of CVD risk (Warden1993)), although an APOA2 serious deficit is not related to lipid profile change or CVD (Deeb,1990). It is has been found from several studies that apoprotein values increase during postprandial phase and also after the ingestion of SFA rich diets. A proatherogenic effect that counteracts the APOA1 effect on HDL has been seen as a possibility following studies that APO1 and APOA2 HDL have poorer tissue cholesterol clearance rates than those that have the APOA1 only (Lagrost,1994; Huang,1995; Parra,1992; Ribbas,2004). At a biochemical level, the APOA2 has a higher HDL affinity than APOA1 as it has a greater hydrophobicity degree (Kalopissis, 2003). A rise in the levels of APOA2 such as witnessed in the postprandial state, results in the production of a partial HDL APOA1 substitution by APOA2 thus accelerating its rate of catabolism (Kalopissis,2003;Ribbas 2004). In addition, the HDL APOA1 reduction results in the reduction of HDL particle size as well as a reduction in LCAT activity (Schulz,1992). Studies on gene variations in this region where polymorphism is found at 1q23 have previously been related to disease prevalence such as family hyperlipemia and diabetes mellitus (Elbein,2002; Beekman,2002; Allayee,2003). A study by Lista et al. (2007) analyzing the Postprandial phase revealed lower levels of TRLTG and total TG. The findings from the study were corroborated by AUC for the time and ANOVA for repeated measures, with a reduced cholesterol level in small TRL. The study did not reveal the precise mechanism via which the particular polymorphism is capable of affecting the metabolism of proteins. However it is known that APOA2 overexpression increases levels of plasma fatty acids (Weng,1996)), which makes its peripheral utilization difficult, increases its stay within the bloodstream, and encourages accumulation within the fatty tissues (van t’ Hooft,2001). The presence of (CC/TC) minor allele of this polymorphism provokes a transcription activity reduction of APOA2 gene promoter suggesting that gene carriers produce less APOA2 when responding to its stimulating factors including postprandial situation. CC homozygotes have been shown to have higher WC, BMI, BF%, food consumption, visceral fat and HOMA-IR than the T allele carriers. A transition T–C at position−265 (Rs5082) has been shown to be related to fat depot in abdomen amongst women (Lara-Castro et al., 2005) An association has been found between APOA2 −265TNC polymorphism with obesity or BMI only in the intake of high saturated fat in three populations in America (Corella et al., 2009). Moreover, the diet-gene interaction has been studied in other areas such as Asia and Europe, which showed that intake of saturated fats in low quantities of b22 g/day showed that the SNP has no effect on obesity or BMI. However, high intake of saturated fat (N=22 g/day) showed significant differences in variables concerning anthropometric factors detected between individual that were CC allele carriers and those that are T-allele carriers. Further micronutrient adjustment had no effect on the significance of findings, which supported saturated fat specificity as a catalyst of this interaction (Corella et al., 2011). Other studies have reported differences that are specific genotype associated with behaviors that are intake-related which could contribute to risk of obesity, identification of ghrelin possible role in APOA2 modulation nutrient interactions (Smith et al., 2012). Eating behaviors have also been shown as being related to risk of obesity (Bibiloni et al., 2010; Schlundt et al., 2003) and seem to be linked to APOA2 genotype in ways that are in line with risk of obesity. The relationship between saturated fat, APOA2 and food intake hormonal regulation has been identified, and may play a critical role in controlling weight in individuals. The saturated fat and APOA2 interactions for obesity could be mediated through the plasma ghrelin modulation and knowledge expansion of obesity and APOA2 to include the modulation of hormonal mediators and specific behaviors will increase the pool of knowledge on gene-diet interactions as well as facilitate future pragmatic goals in the development of genotype based dietary guidelines (Corella et al., 2011). Lower levels of saturated fat have been shown to be associated with lower levels of ghrelin in the CC carriers, which theoretically may be expected to result in lower energy intake as well as a smaller body size.(Zaki et al.,2013) 5.0 Conclusion The project that has been discussed in this paper focused on the purification of DNA from six cell lines of which two were used. These were the MM6 and THP1 cell lines as they were the ones that showed clear bands in the electrophoresis gel. The cell lines were then analyzed to determine the SNP location for APOA2 gene, and it was found that the MM6 had a C allele at the polymorphism location while the THP1 had TT alleles. Studies that have been done have shown that the minor allele -265T/C SNP presence reduced the production of APOA2 and also resulted in the reduction of postprandial metabolism. From the gel electrophoresis done in this study of the THP1 and MM6, it can be seen that the allele -265 T/C is present in MM6 cell line and not in the T/T THP1 cell line. Based on the vant Hooft results, it can be assumed that the MM6 cell line will have a reduction in APOA2 promoter and subsequent reduction in fat metabolism. The sample carrier is then assumed to be at high risk of being obese due to decreased cellular metabolic activity. At a biochemical level, the APOA2 has a higher HDL affinity than APOA1 as it has a greater hydrophobicity degree. A proatherogenic effect that counteracts the APOA1 effect on HDL has been seen as a possibility following studies that APO1 and APOA2 HDL have a poorer tissue. The presence of (CC/TC) minor allele of this polymorphism provokes transcription activity reduction of APOA2 gene promoter suggesting that gene carriers produce less APOA2 when responding to its stimulating factors including postprandial situation, cholesterol clearance rates than those that have the APOA1 only (Lagrost,1994; Huang,1995; Parra,1992;Ribbas,2004). A transition T–C at position−265 (Rs5082) has been shown to be related to the fat depot in abdomen amongst women (Lara-Castro et al., 2005). Eating behaviors have also been shown as being related to risk of obesity (Bibiloni et al., 2010; Schlundt et al., 2003) and seem to be linked to APOA2 genotype in ways that are in line with risk of obesity. The saturated fat and APOA2 interactions for obesity could be mediated through the plasma ghrelin modulation and knowledge expansion of obesity and APOA2 to include the modulation of hormonal mediators and specific behaviors will increase the pool of knowledge on gene-diet interactions as well as facilitate future pragmatic goals in the development of genotype based dietary guidelines. In conclusion, further studies need to be done to understand better the role of APOA2 and perhaps future developments can lead to the discovery of a mechanism that can accelerate metabolism in persons that are CC carriers and help in their weight reduction in a manner that does not risk their health outcomes. References Afman L, Müller M. Nutrigenomics: from molecular nutrition to prevention of disease. J Am Diet Assoc. 2006;106:569–76. [PubMed] Allayee H, Castellani LW, Cantor RM, de Bruin TW, Lusis AJ. Biochemical and genetic association of plasma apolipoprotein A-II levels with familial combined hyperlipidemia. Circ Res. 2003;92:1262–7. Beekman M, Heijmans BT, Martin NG, Pedersen NL, Whitfield JB, DeFaire U, van Baal GC, Snieder H, Vogler GP, et al. Heritabilities of apolipoprotein and lipid levels in three countries. Twin Res. 2002;5:87–97 Bibiloni,M; E. Martinez, R. Llull, M. D. Juarez, A. Pons, and J. A. Tur, “Prevalence and risk factors for obesity in Balearic Islands adolescents,” British Journal of Nutrition, vol. 103, no. 1, pp. 99–106, 2010. Birjmohun RS, Dallinga-Thie GM, Kuivenhoven JA, et al. Apolipoprotein A-II is inversely associated with risk of future coronary artery disease. Circulation. 2007;116:2029–35. [PubMed] Buring JE, O’Connor GT, Goldhaber SZ, Rosner B, Herbert PN, Blum CB, et al. Decreased HDL2 and HDL3 cholesterol, Apo A-I and Apo A-II, and increased risk of myocardial infarction. Circulation 1992;85:22-29 Castellani LW, Nguyen CN, Charugundla S, et al. Apolipoprotein AII is a regulator of very low density lipoprotein metabolism and insulin resistance. J Biol Chem. 2008;283:11633–44. [PMC free article] [PubMed] Castellani LW, Goto AM, Lusis AJ. Studies with apolipoprotein A-II transgenic mice indicate a role for HDLs in adiposity and insulin resistance. Diabetes. 2001;50:643–51. [PubMed] Castellani LW, Navab M, Van Lenten BJ, Hedrick CC, Hama SY, Goto AM, et al. Overexpression of apolipoprotein AII in transgenic mice converts high density lipoproteins to proinflammatory particles. J Clin Invest 1997;100:464-474. Corella D, Tai ES, Sorlí JV, Chew SK, Coltell O, Sotos-Prieto M, et al. Association between the APOA2 promoter polymorphism and body-weight in Mediterranean and Asian populations. Replication of a gene-saturated fat interaction. Int J Obes. 2011; 35: 666–675. doi:10.1038/ijo.2010.187 Corella,D; G. Peloso, D. K. Arnett et al., “APOA2, dietary fat, and body mass index: replication of a gene-diet interaction in 3 independent populations,” Archives of Internal Medicine, vol. 169, no. 20, pp. 1897–1906, 2009 Corella D, Arnett DK, Tsai MY, et al. The -256T>C polymorphism in the apolipoprotein A-II gene promoter is associated with body mass index and food intake in the genetics of lipid lowering drugs and diet network study. Clin Chem. 2007;53:1144–52. [PubMed Corella D, Ordovas JM. Single nucleotide polymorphisms that influence lipid metabolism: Interaction with Dietary Factors. Annu Rev Nutr. 2005;25:341–90. [PubMed] Deeb SS, Takata K, Peng RL, Kajiyama G, Albers JJ. A splice-junction mutation responsible for familial polipoprotein A-II deficiency. Am J Hum Genet. 1990;46:822–7. [PMC free article] [PubMed] Elbein SC, Chu W, Ren Q, Wang H, Hemphill C, Hasstedt SJ. Evaluation of apolipoprotein A-II as a positional candidate gene for familial Type II diabetes, altered lipid concentrations, and insulin resistance. Diabetologia. 2002;45:1026–33. Escola-Gil JC, Marzal-Casacuberta A, Julve-Gil J, Ishida BY, Ordonez-Llanos J, Chan L, et al. Human apolipoprotein A-II is a pro-atherogenic molecule when it is expressed in transgenic mice at a level similar to that in humans: evidence of a potentially relevant species-specific interaction with diet. J Lipid Res 1998;39:457-462. Fager G, Wiklund O, Olofsson SO, Wilhelmsen L, Bondjers G. Multivariate analyses of serum apolipoproteins and risk factors in relation to acute myocardial infarction. Arteriosclerosis 1981;1:273-279 Ferns GA, Shelley CS, Stocks J, Rees A, Paul H, Baralle F, et al. A DNA polymorphism of the apoprotein AII gene in hypertriglyceridaemia. Hum Genet 1986;74:302-306. Frayling TM, Timpson NJ, Weedon MN, Zeggini E, Freathy RM, Lindgren CM, et al. A Common Variant in the FTO Gene Is Associated with Body Mass Index and Predisposes to Childhood and Adult Obesity. Science. 2007; 316: 889–894. doi:10.1126/science.1141634 Fullerton SM, Clark AG, Weiss KM, Taylor SL, Stengard JH, Salomaa V, et al. Sequence 14polymorphism at the human apolipoprotein AII gene (APOA2): unexpected deficit of variation in an African-American sample. Hum Genet 2002;111:75-87. Huang Y, von Eckardstein A, Wu S, Assmann G. Cholesterol efflux, cholesterol esterification, and cholesteryl ester transfer by LpA-I and LpA-I/A-II in native plasma. Arterioscler Thromb Vasc Biol. 1995;15:1412–8. [PubMed] Ioannidis JP, Boffetta P, Little J, et al. Assessment of cumulative evidence on genetic associations: interim guidelines. Int J Epidemiol. 2008;37:120–32. [PubMed] Johnson WJ, Kilsdonk EP, van Tol A, Phillips MC, Rothblat GH. Cholesterol efflux from cells to immunopurified subfractions of human high density lipoprotein: LP-AI and LP-AI/AII. J Lipid Res. 1991;32:1993–2000. [PubMed] Kalopissis AD, Pastier D, Chambaz J. Apolipoprotein A-II: beyond genetic associations with lipid disorders and insulin resistance. Curr Opin Lipidol. 2003;14:165–72. [PubMed] Kelly T, Yang W, Chen CS, Reynolds K, He J. Global burden of obesity in 2005 and projections to 2030. Int J Obes (Lond) 2008;32:1431-7. Lagrost L, Persegol L, Lallemant C, Gambert P. Influence of apolipoprotein composition of high density lipoprotein particles on cholesterylester transfer protein activity. Particles containing various proportions of apolipoproteins AI and AII. J Biol Chem. 1994;269:3189–97. Lara-Castro C, Hunter GR, Lovejoy JC, Gower BA, Fernandez JR. Apolipoprotein A-II polymorphism and visceral adiposity in African-American and white women. Obes Res. 2005;13:507–12. [PubMed] Lista, JD, Jimenez,F, Tanaka,T et al An Apolipoprotein A-II Polymorphism (-265T/C, rs5082) Regulates Postprandial Response to a Saturated Fat Overload in Healthy Men J. Nutr. 137: 2024–2028, 2007 Loos, RJF. The genetic epidemiology of melanocortin 4 receptor variants. European Journal of Pharmacology 2011; 660 :156–164. Loos RJ, Rankinen T. Gene-diet interactions on body weight changes. J Am Diet Assoc. 2005;105:S29–34. [PubMed] Martin-Campos JM, Escola-Gil JC, Ribas V, Blanco-Vaca F. Apolipoprotein A-II, genetic variation on chromosome 1q21–q24, and disease susceptibility. Curr Opin Lipidol 2004;15:247-253. Moleres A, Ochoa MC, Rendo-Urteaga T, Martinez-Gonzalez MA, Julian MC, Martinez JA, et al. Dietary fatty acid distribution modifies obesity risk linked to the rs9939609 polymorphism of the fat mass and obesity-associated gene in a Spanish case–control study of children. Br J Nutr 2012; 107: 533–538. doi:10.1017/S0007114511003424 NCI-NHGRI Working Group on Replication in Association Studies. Chanock SJ, Manolio T, Boehnke M, Boerwinkle E, Hunter DJ, Thomas G, et al. Replicating genotype-phenotype associations. Nature. 2007;447:655–60. [PubMed] Ordovas JM, Corella D. Nutritional genomics. Annu Rev Genomics Hum Genet. 2004;5:71–118. [PubMed) Parra HJ, Arveiler D, Evans AE, Cambou JP, Amouyel P, Bingham A, McMaster D, Schaffer P, Douste-Blazy P, et al. A case-control study of lipoprotein particles in two populations at contrasting risk for coronary heart disease. The ECTIM Study. Arterioscler Thromb. 1992;12:701–7. Rankinen T, Zuberi A, Chagnon YC, Weisnagel SJ, Argyropoulos G, Walts B, et al. The human obesity gene map: the 2005 update. Obesity (Silver Spring) 2006;14:529-644 Ribas V, Sanchez-Quesada JL, Anton R, CamachoM, Julve J, Escola-Gil JC, Vila L, Ordonez-Llanos J, Blanco-Vaca F. Human apolipoprotein A-II enrichment displaces paraoxonase from HDL and impairs its antioxidant properties: a new mechanism linking HDL protein composition and antiatherogenic potential. Circ Res. 2004;95:789–97. Ridker PM, Rifai N, Cook NR, Bradwin G, Buring JE. Non-HDL cholesterol, apolipoproteins A-I and B100, standard lipid measures, lipid ratios, and CRP as risk factors for cardiovascular disease in women. JAMA 2005;294:326-333. Schlundt,DG; M. K. Hargreaves, and M. S. Buchowski, “The Eating Behavior Patterns Questionnaire predicts dietary fat intake in African American women,” Journal of the American Dietetic Association, vol. 103, no. 3, pp. 338–345, 2003. V Schultz JR, Verstuyft JG, Gong EL, Nichols AV, Rubin EM. Protein composition determines the anti-atherogenic properties of HDL in transgenic mice. Nature. 1993;365:762–4. [PubMed] Schultz JR, Gong EL, McCall MR, Nichols AV, Clift SM, Rubin EM. Expression of human apolipoprotein A-II and its effect on high density lipoproteins in transgenic mice. J Biol Chem 1992;267:21630-21636 Scott J, Knott TJ, Priestley LM, Robertson ME, Mann DV, Kostner G, et al. High-density lipoprotein composition is altered by a common DNA polymorphism adjacent to apoprotein AII gene in man. Lancet 1985;1:771-773 Smith,CE; J. M. Ordovás, C. Sánchez-Moreno, Y. C. Lee, and M. Garaulet, “Apolipoprotein A-II polymorphism: relationships to behavioural and hormonal mediators of obesity,” International Journal of Obesity, vol. 36, no. 1, pp. 130–136, 2012. Tailleux A, Duriez P, Fruchart JC, Clavey V. Apolipoprotein A-II, HDL metabolism and atherosclerosis. Atherosclerosis 2002;164:1-13. Tailleux A, Bouly M, Luc G, Castro G, Caillaud JM, Hennuyer N, et al. Decreased susceptibility to diet-induced atherosclerosis in human apolipoprotein A-II transgenic mice. Arterioscler Thromb Vasc Biol 2000;20:2453-2458 Takada D, Emi M, Ezura Y, et al. Interaction between the LDL-receptor gene bearing a novel mutation and a variant in the apolipoprotein A-II promoter: molecular study in 1135-member familial hypercholesterolemia kindred. J Hum Genet. 2002;47:656–664. [PubMed Tao Y. Mutations in Melanocortin‐4 Receptor and Human Obesity. Progress in Molecular Biology and Translational Science 2009; 88:173-204. DOI: 10.1016/S1877-1173(09)88006-X Tso P, Liu M. Apolipoprotein A-IV, food intake, and obesity. Physiol Behav 2004;83:631-643. van t Hooft FM, Ruotolo G, Boquist S, de Faire U, Eggertsen G, Hamsten A. Human evidence that the apolipoprotein A-II gene is implicated in visceral fat accumulation and metabolism of triglyceride-rich lipoproteins. Circulation. 2001;104:1223–8. [PubMed] Vohl MC, Lamarche B, Bergeron J, Moorjani S, Prud’homme D, Nadeau A, et al. The MspI polymorphism of the apolipoprotein A-II gene as a modulator of the dyslipidemic state found in visceral obesity. Atherosclerosis 1997;128:183-190 Warden CH, Hedrick CC, Qiao JH, Castellani LW, Lusis AJ. Atherosclerosis in transgenic mice overexpressing apolipoprotein A-II. Science. 1993;261:469–72. [PubMed] Warden CH, Daluiski A, Bu X, Purcell-Huynh DA, De Meester C, et al. Evidence for linkage of the apolipoprotein A-II locus to plasma apolipoprotein A-II and free fatty acid levels in mice and humans. Proc Natl Acad Sci U S A 1993;90:10886-10890 Wardle J, Carnell S, Haworth CM, Farooqi IS, O’Rahilly S, Plomin R. Obesity Associated Genetic Variation in FTO Is Associated with Diminished Satiety. J Clin Endocrinol Metab 2008:93: 3640–3643. Weng W, Breslow JL. Dramatically decreased high density lipoprotein cholesterol, increased remnant clearance, and insulin hypersensitivity in apolipoprotein A-II knockout mice suggest a complex role for apolipoprotein A-II in atherosclerosis susceptibility. Proc Natl Acad Sci USA. 1996;93:14788–94 Xiao J, Zhang F, Wiltshire S, et al. The apolipoprotein AII rs5082 variant is associated with reduced risk of coronary artery disease in an Australian male population. Atherosclerosis. 2008;199:333–9. [PubMed) Zaki ,M; Amr,K and Hamid,M. Evaluating the association of APOA2 polymorphism with insulin resistance in adolescents. Cholesterol Volume 2013 (2013), Article ID 289481, 5 pages http://dx.doi.org/10.1155/2013/289481 Ziegler-Heitbrock, H. W. L., E. Thiel, A. Fu¨tterer, V. Herzog, and A. Wirtz.1988. Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes. Int. J. Cancer. 41:456–461. Read More