StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Premium+

DNA Extraction - Essay Example

Comments (0) Cite this document
Summary
This is the "DNA Extraction" essay. A lot of information is found and studied through the learning of deoxyribonucleic acid…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER96.2% of users find it useful

Extract of sample "DNA Extraction"

Download file to see previous pages Below is a list of materials required to start up the experiment:
  • 1-10 milliliter calibrated cylinder
  • 2-100 milliliter Beakers
  • 1 resealable bag
  • 1 elastic strap (should be large and contain liquid)
  • Standing test tube ligneous mixing rod fresh
  • Soft fruitlet, for instance, apple, damson
  • Scissors
  • Chromosome extrication
  • Icy ethanol
  • Ice exposition
  • Rock salt
  • Washing-up liquid
  • Ethanol frost water
  • 15m cheesecloth
Procedure
  • Lysis buffer preparation on a 90 mL distilled water
  • Mix 1.5g of salt with 10 mL of alcohol.
Store water in the refrigerator for about 1 hour before use. Wear gloves before you begin the experiment. Ethanol is prepared in a deep freezer for about one hour. Afterward, introduce the soft fruit slices keenly on a synthetic fastener bag, squeeze the fruit in the bag with your hand. Make sure the amount of food is equivalent to the quantity of approximately five grapes. With the help of a 10 milliliter calibrated cylinder, ration 10 milliliters of the DNA abstraction solution, then relocate the solution to the container with the fruit from the conduit. Subsequently, fasten the bag wholly, knead the bag for 120 seconds while blending. Attach the middle of the filter cloth above the opening of the test tube to generate a sieve. Shove it inside the tube of a depth of roughly two shuffles, shelter the filter cloth using an elastic girdle on the upper part of the test tube. Pierce the apex of the sack, in addition to sieve the extrication by bucketing it inside the filter cloth. The next phase is to retain the sifted soluble solution into the constant test tube. Clean the 10 milliliters calibrated cylinder. After rinsing, estimate 5 milliliters of the icy ethanol. While supporting the standing test tube at an angle of 45, smoothly shift the ethyl alcohol inside the test duct with the sieved solution. Using a constituent which sparks beneath black light, boost the color of the fruit. After this step, augment ethanol to the solution, the deoxyribonucleic acid will then expedite. Place the test tube on a stationary location for about 3-6 proceedings unperturbed. Thereafter, you should then start seeing air formation of air bubbles at the borderline amid the ethanol and the strained solution. You will see the DNA detached on the upper part of the ethanol as bubbles appear adjacent to the vertex. Gradually attach the stirring rod into the test duct. After this, you elevate and lower the tip severally to roll then assemble the DNA. In case there is a limited amount of DNA available, it may not drift to the upper part of the solution in a way that can be easily detached from the tube. Nonetheless, the DNA will still stay observable as bright clusters gently riveting the solution will drive the clusters near the vertex. At this point, the DNA is greasy. In this stage, the DNA is relatively vast, and it requires to intermingle with a lot of water. When you supplement salt, the water partially networks with the salt because of its tiny nature, which gives it the capability to move around the solution easier contrasted to the deoxyribonucleic acid. It makes it less soluble since there is less availability of water to interact with the DNA. Below are some of the conclusions drawn out from the experiment:
  • The DNA is more soluble in alcohol compared to an aqueous solution. It is since alcohol is more non-polar rather than water, which is polar. The polar water fragment is highly preferred when dispensing the negative infuse on DNA, triggering it to remain in solution. Nevertheless, since alcohol is non- polar, its negatively stimulated molecules of DNA lean towards being organized, thus creating a precipitate from the alcoholic solution.
  • To eliminate the remains in the alky solution is quite simple. One has to be capable of centrifuge again so that the DNA creates a pellet and channel the fluid out.
After the experimentation, a great difference in the volume of precipitated DNA is observable in the standing test tube. This result could have existed due to the amount of solution present in the bag after smashing taking place. A conclusion can be made that DNA extraction does vary as well as appearance. The DNA removed from detergent spurts exposed the cells of the fruit. It discharges DNA.  Salt helps show that proteins in the cells are not disconnected from the rest of the mixture in the DNA. The ethanol helps invisibility. DNA particles are insoluble and accumulate together to become visible. ...Download file to see next pagesRead More
Cite this document
  • APA
  • MLA
  • CHICAGO
(DNA Extraction Essay Example | Topics and Well Written Essays - 750 words, n.d.)
DNA Extraction Essay Example | Topics and Well Written Essays - 750 words. https://studentshare.org/biology/2089785-dna-extraction-premium-essay
(DNA Extraction Essay Example | Topics and Well Written Essays - 750 Words)
DNA Extraction Essay Example | Topics and Well Written Essays - 750 Words. https://studentshare.org/biology/2089785-dna-extraction-premium-essay.
“DNA Extraction Essay Example | Topics and Well Written Essays - 750 Words”. https://studentshare.org/biology/2089785-dna-extraction-premium-essay.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF DNA Extraction

DNA

...DNA Extraction... DNA Extraction... inheritance of ABO blood type ABO blood type characterizes red blood cell membrane glycoproteins. ABO blood typing is important in cases of transfusion, as incompatibility may cause fatal immune reactions. Phenotypes can either be A, B, AB, or O. It is determined by the combination of multiple alleles, IA, IB and i, which produces six combinations of genotypes: IAIA and IAi, which produces phenotype A, IBIB and IBi, which produces phenotype B, IAIB, which produces phenotype AB, and ii, which produces phenotype O. As can be inferred, its inheritance is ruled by Mendelian codominance, wherein IA and IB are codominant alleles, while i is the recessive allele (Campbell and Reece, 2002). Thus, if a parent with a...
4 Pages(1000 words)Essay

Practical report on DNA Extraction Biological Science

...the individual, its characters and genetic background. There are many protocols of DNA extraction from an organism. Advanced techniques are needed to isolate DNA in a more pure form and require sophisticated equipment and specific chemicals. However, all these methods are based on three basic steps; i.e. separation and opening of cells chemically or mechanically to release DNA, purify DNA by removing proteins and other cell debris and finally, precipitation of DNA using an alcohol (Hoyle, 2011). If these basic steps are practiced, it should be possible to isolate DNA by following simple means and hence the objective of...
4 Pages(1000 words)Assignment

DNA

...DNA Extraction... DNA Extraction... The Unique Qualities of Blood, DNA, and Mitochondrial DNA Your The scene is so common its almost cliche: the courtroom drama climaxing with the identification of the killer by irrefutable DNA samples presented in court; yet what are these samples actually made of, and how do lab technicians utilize the unique qualities of human tissue to make specific identifications? The answer lies in deoxyribonucleic acid (DNA), and its unique composition. Like a fingerprint, each person has a unique DNA sequence that contributes to their individuality (NIH). DNA then goes on to encode for unique proteins that act as markers in the blood, which help lab technicians make specific identifications (NIH). Similarly,...
3 Pages(750 words)Essay

DNA

...DNA Extraction... DNA Extraction... DNA: The Basis of Life The question of “What is life, and what is it made of” has been asked to the point of making it cliche,if not ubiquitous, yet a multitude of answers persist. Life could be defined as a potential, as a response to external stimuli, or even as an indefinable feeling, yet none of these answers attempts to solve the question of what actually drives the biological engine of our bodies that keeps us breathing, pumping blood, and absorbing food. On April 25th, 1953, the now famous scientific pair of Watson and Crick attempted to finally answer this question (Fredholm). They claimed that an elegant molecule called deoxyribonucleic acid, or DNA, was the “God Molecule”, the blueprint for every...
5 Pages(1250 words)Essay

DNA

...DNA Extraction... and protein Database assignment Part 1) Nucleotide numbers constituting the coding sequence of: E1 alpha: NM_000284.3  3390 E1 beta: NM_000925.3  1544 (2) Number of exons and introns present in the genomic sequence of: E1 alpha: NM_000284.3  Exons = 11 Introns = 10 E1 beta: NM_000925.3  Exons = 10 Introns = 9 (3) E1 Beta sequence – BLAST results (Description of three sequences with highest homology): Name Pyruvate dehydrogenase (lipoamide) beta (PDHB) Pyruvate dehydrogenase (lipoamide) beta (PDHB) Pyruvate dehydrogenase (lipoamide) beta (PDHB) Accession number NM_001131433.1 NM_001246418.1 NM_001195394.1 Organism Pongo abelii (Sumatran orangutan) Pan troglodytes (chimpanzee) Macaca mulatta (Rhesus monkey) Descriptio...
3 Pages(750 words)Coursework

Extraction of plasmid DNA and set up of polymerase chain Reaction (PCR)

..., measurement or expression. The information obtained from this can further be used to characterize the resulting protein product or the organism from which it was obtained. Due to the vast amount of processes PCR products can undergo, the technique has been the staple for laboratory diagnosis of diseases, bacteria and virus identification, crime scene investigations, and others. As can be seen, PCR follows and precedes many other molecular processes. In this experiment, plasmids from a transformed bacterial cell pellet were extracted to isolate the gene encoding for red fluorescent protein (RFP). After measuring the amount of DNA extracted, it was then prepared for PCR. Methods The protocols for DNA extraction, quantification...
5 Pages(1250 words)Coursework

Writing a protocol for genomic DNA extraction and PCR

...By The of the The of the School The and where it is located The Protocol Title: to study the protocol for DNA extraction and PCR basing on the methods sections Materials, reagents and equipment The following reagents and materials were used in the process. 10 μM stocks of Lambda primers, PC01: Forward-5’, GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5’-GGTTATCGAAATCAGCCACAGCGCC-3’’, template: bacteriophage lambda DNA (0.3 μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP, dTTP, dGTP, dCTP), 50 mM Mg SO4, PCR grade water , PCR tubes, Nuclease free pipet tips with cotton, filters clean lab mat (Maria & Frank , 10). Procedure: Standard PCR reaction collected from the product manual...
4 Pages(1000 words)Lab Report

Extraction of Bacterial Chromosomal DNA

... NUMBER:…………………………………………. SHS80204-2 Clinical Microbiology & Molecular Biology Practicals Practical Week 28th of January DNA extraction from bacteria Restriction of DNA Results and Discussion for Portfolio. To be handed in in-class on the 11th of February 2010. Extraction of bacterial chromosomal DNA Results. Micrococcus luteus For the diluted DNA OD260 = 0.017ul OD280 = 0.011ul . Dilution factor = 30 fold For the DNA OD260 = 0.51ul OD280 =0.33ul The ratio of OD260/OD280 = 1.545 Convert this to g/ml of DNA using the conversion 1.0 OD260 = 47 g/ml of DNA Concentration of isolated DNA =23.97ug/ml Total volume of DNA =200l. Yield of DNA = 4.794 g. This amount of DNA was isolated was isolated...
7 Pages(1750 words)Essay

DNA Extraction and PCR of Bird DNA for Sex Identification

...DNA Extraction... DNA Extraction... extraction and PCR of bird DNA for sex identification Introduction: DNA is the basic component of genes. It is one of the important molecules of life. The variation in the DNA composition and structure provides variation between the species and within the species. DNA sequence varies among the sexually dimorphic species females and males. The difference in the phenotype is used as the basic identification step. Sometimes the phenotypic identification becomes complex in some species such as birds (they are monomorphic sexually). (Huffman and Wallace 2012). These birds are identified genotypically. The identification of the sex chromosomes will solve the issue. Identification of DNA from the egg shell, feather...
9 Pages(2250 words)Lab Report

Oil Extraction in Russia

...DNA Extraction... DNA Extraction... Extraction in Russia Oil Extraction in Russia Executive Summary Russia ranks among the major world oil producers with utilization of oil dating back to more than five thousands ago. However, the most notable commercial production in Russia is in the early 19th century with produced oil commodity in Russia amounting to three thousands five hundred tons in 1825. Further improvement s ensured doubling the output in the mid 19th century with the 20th century marking Russia as the world’s major oil producer with almost half of the oil produced coming from the country. The commodity has played a significant role in the human life as it serves as a driver to many activities across the world. The introduction of...
7 Pages(1750 words)Assignment
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Essay on topic DNA Extraction for FREE!

Contact Us