StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

Cultural Inequality: If I Were a Poor Black Kid by Gene Marks - Book Report/Review Example

Comments (0) Cite this document
Summary
An author of the following paper seeks to describe his reflection on an article about racial discrimination and equality in the US. The writer claims that if he fell into the category of black kids, the first thing would be to work hard in order to attain the best grades…
Download full paperFile format: .doc, available for editing
GRAB THE BEST PAPER95.5% of users find it useful
Cultural Inequality: If I Were a Poor Black Kid by Gene Marks
Read TextPreview

Extract of sample "Cultural Inequality: If I Were a Poor Black Kid by Gene Marks"

Article Review of "If I Were a Poor Black Kid" by Gene Marks
Recently, President Barrack Obama gave a very good speech regarding inequality in America while he was in Kansas. The president recognized that this is the matter at hand during this tenure, adding that this is the only time that the middle class and all those who are struggling to have a glance at the middle class can make or break it. Whatever is at stake is whether America will be a country where working class can earn reasonably to bring up families, create a modest savings, secure retirement and own a home as well.
The president was very right, this owe to the fact that the spread between the poor and the rich has widen over decades, on the other hand, opportunities for ninety-nine percent have turned to be unachievable dream.
Mr. Barrack Obama’s speech left me thinking very hard. All my children are no smarter as compared to kids of their age from inner city of America. All my kids find it much easier as compared to their counterparts from western Philadelphia. Generally, the world appears unfair to those children simply because these kids had the misfortune of being brought into the world two miles apart into the world that is more difficult and being blessed with a skin color that prevents them from realizing the opportunities that President Barrack Obama was referring to. This is a fact presently.
I don’t fall under the category of poor black kid; I am just a middle aged white person originating from a white middle class background. It simply means that life was much simpler for my case. It is my sincere believe that everybody in America has the opportunity to succeed; even a poor black child from West Philadelphia.
It takes several things such as brains, hard work, little help from others and a little luck as well as available skills to utilize the resources that are in place. For instance technology; technology can greatly change how we utilize the resources we have at hand to benefit us greatly.
In case I fell under the category of black kids, the first thing would be to work hard in order to attain best grades. I would prioritize it minus caring whether I come from a public middle school built at the inner city. It is true that even the worst normally have their best. In addition, the very best students in the middle public schools usually have great opportunities. Getting good grades is key to everything and this needs no more explanation. If one performs poorly in these middle schools, it implies that he is limiting the limited opportunities available.
At times we find ourselves in situations that we don’t wish for not because of our own likeness, but nature defines so, but it should not be the end of everything; even God says that he will always make us the head and not the tail but only if we are ready to be helped. The poor should be very innovative and would land themselves even past the so called rich at the moment.
Cited work
Brown, Michael K. Whitewashing Race: The Myth of a Color-Blind Society. Berkeley: University of California Press, 2003. Internet resource. Read More
Tags
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Cultural Inequality: If I Were a Poor Black Kid by Gene Marks Book Report/Review”, n.d.)
Cultural Inequality: If I Were a Poor Black Kid by Gene Marks Book Report/Review. Retrieved from https://studentshare.org/english/1835579-article-review-of-if-i-were-a-poor-black-kid-by-gene-marks
(Cultural Inequality: If I Were a Poor Black Kid by Gene Marks Book Report/Review)
Cultural Inequality: If I Were a Poor Black Kid by Gene Marks Book Report/Review. https://studentshare.org/english/1835579-article-review-of-if-i-were-a-poor-black-kid-by-gene-marks.
“Cultural Inequality: If I Were a Poor Black Kid by Gene Marks Book Report/Review”, n.d. https://studentshare.org/english/1835579-article-review-of-if-i-were-a-poor-black-kid-by-gene-marks.
  • Cited: 0 times
Comments (0)
Click to create a comment or rate a document

CHECK THESE SAMPLES OF Cultural Inequality: If I Were a Poor Black Kid by Gene Marks

Some Say I Was Poor

... is that we belonged to a poor community as a whole. In those times the neighbours had great respect for each other and in our town all our neighbours used to share things with each other. I still remember this as a positive gesture during my childhood which helped me to learn more about life and care. Gradually with time all of my siblings including me started walking on a path which led to a better future. We all have grown up to get used to the culture of the world today. Some of my siblings joined school whereas some went to trade schools only to become successful. With struggle and hope all of us have become professionals in the world today to lead a better life than we had when we were children. Although we can still not be classified...
3 Pages(750 words)Essay

Gene therapy

.... In ex-vivo therapy, gene delivery is done in cells after being removed from the body (Hecht, 2004). The cells used thus are basically grown in the laboratory. The cells are than modified outside the body and then transplanted back into the body. In some research trials, cells from blood or born marrow are taken out and cultured in a laboratory. Thereafter, the cells are exposed to the virus with the desired gene. The virus infects the cells and transfers the therapeutic genetic material into the nucleus of the cells. After this, the cells are injected into the patient’s body by vein. In in vivo therapy, gene delivery is done in the cells that are still in the body. The simplest method of introducing therapeutic genetic material...
5 Pages(1250 words)Essay

Huge inequality between Poor and Rich in China

...?Huge inequality between Poor and Rich in China China has been one of the fast developing economies globally since last 25 years and resulted in amazing upsurge in per capita revenue and a drop in the poverty level from 64% at the start of reform to 10% in 2004. However, simultaneously, various kinds of inequalities such as income disparity have increased, because of the rural-urban income gap. And also there have been increases in unfairness in health and education areas. Certain amount of inequality was unavoidable as China entered in a market system, however inequality have worsened instead of lessening due to number of strategy issues (Dollar ). According to Gini Index, released recently indicates the income inequality between rich...
7 Pages(1750 words)Essay

Gene Patenting

Expressed sequence tags (ESTs) with 300 to 500 base gene fragments, represent about only 10 to 30% of the average cDNA. cDNA is a laboratory synthesized DNA that contains only exons in their fragment. These allow the genetic researchers to limit their research to only information containing gene fragments.
Patenting of gene fragments has sparked controversy. This is because researchers feel that allowing many patents on gene fragments of same genome adds up to costs to the researcher who is interested in examining the whole genome. The researcher will not only have to pay to each patent holder in order to get an opportunity to study each gene fragment, the researcher will also have to pay the people he has hired to study diff...
5 Pages(1250 words)Essay

Gene Determination

...Gene Determination Q1. Birth defect of the sex organs (Genital Birth Defects) that result in a problem with assigning a definite sex to a newborn child is known as Ambiguous Genitalia or Atypical Genitalia (Committee on Genetics, 2000, Birth Defects, 2005). This condition is said to occur in about one in every 3,000 live births and is characterized by the presence of either a combination of male and female external genitalia or an external genitalia that cannot be clearly assigned to a gender (Birth Defects, 2005). To properly understand the occurrence and causes of this condition, a clear understanding of the normal genetic and hormonal influences that interplay in genital formation and development is important (Committee on Genetics...
7 Pages(1750 words)Essay

Globalization Impacts on the Poor and Inequality

...Globalization Impacts On The Poor And Inequality The impact of globalization on poverty is one of the crucial concerns of globalization’s critics today (Harrison, 2007). Apparently, globalization has several benefits for the poor; in the last two decades, with increased economic integration of developing countries, poverty rates have decreased by half. The World Bank’s annual statistical report, World Development Indicators 2004 (WDI) reveals that the number of people living in extreme poverty has declined from 40 percent to the 21 percent of the global population (WTO, 2008). Moreover, due to the reduction and elimination of restrictions on international trade and financial transactions, capital can flow freely to the poorest...
10 Pages(2500 words)Research Paper

Kid Eat Healthy

... xx March Kids Eat Healthy The current elementary specifically here in the United States, are very lucky because they have all the resources necessary for their education. They have their books, financial assistance, competitive and highly trained educators, a curriculum appropriate to the learning needs of students, comfortable classrooms, complete facilities and most importantly, a healthy mind and body to make the most out of their learning experience. Contrary to todays situation of elementary students here in America, in Ethiopia, my mother country, students have poor education that places them at a disadvantage (Nguyen, Moses and Gabroy). At least based on my personal experience, when I had my elementary study in Ethiopia I felt so...
2 Pages(500 words)Essay

Gene

... for further experiments on G6Pase. C). Diagram of the intron/exon structure of human G6Pase ↓ * * ↕ Figure 1. The 12.5 kb human G6Pase gene located at chromosome 17 is composed of five exons (black portions). Exon 1 runs from bases 80 – 309; exon 2 runs from bases 3134 – 3243; exon 3 runs from bases 6726 – 6831; exon 4 runs from bases 8506 – 8621 and exon 5 runs from bases 10118 – 10629. The start codon is located at exon 1 (marked by down arrow), while the stop codon is located at exon 5 (marked by double-headed arrow). The mutations discussed below are located at the regions marked by asterisks. Identification of mutations in von Gierke disease D). Sequence variation in exon 3 In wild-type, 5’ GGCACAGCAGGTGTATACTACGTGATGGTCACA 3...
8 Pages(2000 words)Essay

Inequality between the Rich and the Poor: Hunger Games

Hunger Games is an event which is held annually which a boy and a girl in the 12 districts of that are around capitol compete in the mass media or the television. The young boy and the girl are 12-18 years who are selected from the 12 districts that surround capitol. Panem is the nation that Hunger Games took place which is in North America. This nation has 12 districts with Capitol being one of the districts that are the wealthiest district. All the other 12 districts are poor but District 12 is located in a region where coal is available in plenty, the region was known as Appalachia. In each and every district on annual basis, a boy and a girl who are in the age of 12 to 18 are taken where they compete in a battle of death where...
5 Pages(1250 words)Essay

Men in Black; I, Robot; After Earth

This research will begin with the movie review of Men in Black. It is an American movie released in the year 1997 and is based on science fiction. This action comedy movie is directed by Barry Sonnenfeld with actors including Will Smith, Tommy Lee Jones, Rip Torn and Linda Florentino. The plot of the movie has been adapted from a comic book series with the same name. The story revolves around two men, also known as men in black, who are representatives of a non-government agency. They observe the activities and movements of some extraterrestrial beings who are residing on this earth by hiding their identity from regular human beings. The major focus of this agency’s men is to observe the movements of 1,500 alien figures w...

10 Pages(2500 words)Movie Review

Teaching for Social Justice

... fact. Modern molecular genetics has established that genetic profiles cannot divide humanity into any definitive types. There aren't any 'genetic' markers for race or ethnicity. In fact intermingling of genes is a characteristic feature of the human species that has resulted due to years and years of traveling, trading, migration, pilgrimage, invasion and conquest. The nurture and active proliferation of inequality in varied forms and in many cultures can be related to or is a result of the arrogance of power. The subjugation of vast masses and the control it affords to those holding the reins of power, to write the destiny of hapless individuals, is a heady mix. It intoxicates the powerful with furthering their economic interests giving...
9 Pages(2250 words)Essay

Ethnic Culture and Behavior in Brazil

... the other ethnic and racial groupings that came to Brazil in the later years. The results were a mixture of combinations of various degree and variations thus a popular phrase that Brazil is a racial democracy. This phenomenon led the population of blacks to decrease while that of mulattoes increased (Martin, 2008). Class System in Brazil Despite brazil being one of the ten largest economies of the world, it’s the most unequal society in the world with the most unequal distribution of income and wealth and this inequality has been rising. Over thirty million Brazilians live in poverty including twenty million workers and ten million pensioners. These differences between the rich and poor have characterized the Brazilian nation since...
9 Pages(2250 words)Research Paper

Inequality in African Immigrants' Health Care in the United Kingdom

..., the high mortality rate of Irish immigrants in England was attributed to their poor socioeconomic status (Harding & Rosato, 1998). Over the years, the effect of socioeconomic status on health inequality still remains the same. However, the only difference is that the black immigrants from Africa are the latest victims. Some researchers have argued that genetic and cultural elements of ethnicity play a greater role than socioeconomic status in health inequality. The crude explanations that are brought forward are showing a worrying trend since most of these explanations are based on cultural stereotypes and genetic differences. Ethnicity The United Kingdom is currently more diversified than ever. One out of ten people one is a black...
14 Pages(3500 words)Coursework
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you another Book Report/Review on topic Cultural Inequality: If I Were a Poor Black Kid by Gene Marks for FREE!

Contact Us