StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Practical report on DNA Extraction Biological Science - Assignment Example

Cite this document
Summary
Extraction of DNA from Kiwi fruit ABSTRACT Extraction of DNA from a Kiwi (Actinidia deliciosa) fruit was attempted using simple household items. The fruit was peeled, chopped and macerated with extraction buffer made from washing up liquid, salt and water…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER92% of users find it useful
Practical report on DNA Extraction Biological Science
Read Text Preview

Extract of sample "Practical report on DNA Extraction Biological Science"

Download file to see previous pages

This proved to be a successful method to extract DNA from a Kiwi fruit in a quantity that permit visualization without a high-power microscope. INTRODUCTION DNA (deoxyribonucleic acid) is the basic structure of all living organisms (plants, animals, humans, microbes) and is present in the cells, especially in the cell nucleus. They are made from simple units known as ‘nucleotides’. Genes, which carry all information (structure, behavior, functions) of a cell or an organism, are made from long strands of DNA and this DNA is copied and inherited through generations from parent to the offspring.

Hence, DNA is used in producing genetically modified plants and animals, in identifying variations/similarities of plant types, in medical research and in forensic medicine and in manufacturing pharmaceuticals (Jie, 2011). Isolated DNA from a tissue of a plant, animal, microbe or a human is therefore very useful since it provide much information about the individual, its characters and genetic background. There are many protocols of DNA extraction from an organism. Advanced techniques are needed to isolate DNA in a more pure form and require sophisticated equipment and specific chemicals.

However, all these methods are based on three basic steps; i.e. separation and opening of cells chemically or mechanically to release DNA, purify DNA by removing proteins and other cell debris and finally, precipitation of DNA using an alcohol (Hoyle, 2011). If these basic steps are practiced, it should be possible to isolate DNA by following simple means and hence the objective of this study was to extract DNA from a Kiwi fruit using household items. MATERIALS AND METHODS A fruit of Kiwi (Actinidia deliciosa), otherwise known as ‘Chinese gooseberry’, was used to extract DNA.

Outer skin of the fruit was peeled off and the fruit was chopped into small pieces using a knife. These pieces were put into a jar and mashed thoroughly to break open cells and enhance release of DNA. The Extraction buffer (Table 1) was added into fruit pulp and continued further mashing to enhance release of more DNA. Table 1. Composition of the extraction buffer Component Quantity Washing up liquid 5g Salt 2g Tap water 100ml All components were mixed and stirred slowly until salt was completely dissolved.

This Kiwi - buffer mixture was then incubated at 600 C for 15 min. by carefully immersing the jar in a water bath. The water bath was prepared by filling a large basin with approximately equal volumes of normal tap water and boiling water from a kettle. The precise temperature was maintained by using a thermometer. After 15 minutes, the jar was removed from the water bath and the content was filtered through a fine sieve (coffee filter) into a fresh jar to separate Kiwi DNA from other cellular debris.

Ice-cold alcohol was pre-prepared by freezing methylated spirit for a minimum of 30 min period and this was carefully poured down the inside of the jar containing Kiwi DNA suspension. RESULTS A yellow-green colored filtrate was observed after filtering the incubated mixture of fruit pulp and buffer. When ice-cold alcohol was added into this filtrate, a transparent layer was formed on top of the Kiwi mixture as alcohol has lesser density than the mixture. Gradually, a white substance began to appear at the bottom of the ice cold alcohol layer where it met the Kiwi DNA suspension.

This white substance was Kiwi DNA and could be collected using a small spatula made from a curved paper clip. DISCUSSION Since all living

...Download file to see next pages Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“Practical report on DNA Extraction Biological Science Assignment”, n.d.)
Retrieved from https://studentshare.org/family-consumer-science/1414131-practical-report-on-dna-extraction-biological
(Practical Report on DNA Extraction Biological Science Assignment)
https://studentshare.org/family-consumer-science/1414131-practical-report-on-dna-extraction-biological.
“Practical Report on DNA Extraction Biological Science Assignment”, n.d. https://studentshare.org/family-consumer-science/1414131-practical-report-on-dna-extraction-biological.
  • Cited: 3 times

CHECK THESE SAMPLES OF Practical report on DNA Extraction Biological Science

DNA Barcoding Invertebrate Lab Report #1

These sequences are later Biology Topic: lab report on dna barcoding Introduction: DNA barcoding provides a versatile tool for ification of organism based on DNA taxonomy and delimitation and ‘discovery' of new species.... biological identificationsthrough DNA bar codes.... Proceedings of the Royal Society of London B biological Sciences 270: 313–321.... In the second stage, laboratory analysis which involves extraction of genetic material to obtain DNA batcode sequence is done....
2 Pages (500 words) Lab Report

Biological Identifications Through DNA Bar Codes

Genomic DNA is isolated via the fast dna extraction method from fresh or frozen specimens.... This paper outlines that dna barcoding is a standardized method of identifying the organism by using small segments of their dna.... Essentially it is a dna based identification method which among provides a more advanced species identification as compared to the traditional species identification.... hellip; As the discussion stresses, the quality of the sample dna dictates the effectiveness of the dna barcoding process....
2 Pages (500 words) Lab Report

Writing a protocol for genomic DNA extraction and PCR

Caution and extreme should be maintained while to bid avoid any aspirating the pellet In conclusion, the protocol for dna extraction and the PCR based typically on the main methods takes subsequent steps.... In the process of extraction large quantities of the DNA may be necessitate heating briefly at 65oC) for the suspension.... 10 μM stocks of Lambda primers, PC01: Forward-5', GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5'-GGTTATCGAAATCAGCCACAGCGCC-3'', template: bacteriophage lambda dna (0....
4 Pages (1000 words) Lab Report

DNA Extraction and PCR of Bird DNA for Sex Identification

The "dna extraction and PCR of Bird DNA for Sex Identification" paper aims to extract the DNA from the muscle, blood, and feather of Gallus gallus and to estimate the concentration of the DNA from the three samples and amplify the CHD1 gene using PCR.... hellip; dna is the basic component of genes.... The variation in the dna composition and structure provides variation between the species and within the species.... dna sequence varies among the sexually dimorphic species females and males....
9 Pages (2250 words) Lab Report

Practical Report on Life Cell Cycle of Fission Yeast

The study "practical report on Life Cell Cycle of Fission Yeast" determines the amount of DNA present in the samples, estimate the timing of G1, S and G2 phases of the cell cycle for this yeast organism under the growth, the timing of the different stages of the cycle of Schizosaccharomyces pombe.... ure dna extracts may be easily estimated by the method of spectrophotometry.... This is because dna at 260nm can absorb maximally....
7 Pages (1750 words) Lab Report

The Use of the SV Total RNA Isolation System

The requirement for techniques to segregate high-quality RNA swiftly, free of genomic dna infectivity significantly, from small amounts of starting material (i.... To trim down genomic dna to a large extent, which can impede the amplification-based techniques, a DNase treatment step has been added by the system as well.... In this what happens is the insertion of the outside dna into the plant cells/tissues....
9 Pages (2250 words) Lab Report

Information Extraction System Using Keyword Matching

This report "Information extraction System Using Keyword Matching" presents an information extraction system by use of keywords.... The information extraction system in the hospital has to be managed in a new way to provide efficient services to the people (Carter, 2001).... apid communication due to efficient information extraction, will lead to a reduction in the time of stay and omit redundant diagnostic instructions.... nformation extraction by use of keyword matching is the process of extracting user text from a set of documents....
9 Pages (2250 words) Report

DNA Extraction and Polymerase Chain Reaction of Bird DNA for Sex Identification

The paper "dna extraction and Polymerase Chain Reaction of Bird DNA for Sex Identification" determines the sex of individual species using different samples of DNA from blood, muscle, and feather of Gallus gallus.... nbsp; The use of PCR in the genetic sex identification of birds is ideal since it requires just a small sample, like a blood drop or a feather for dna extraction, minimizing individual bird's trauma....  This can be done through the extraction of genomic DNA from a small tissue sample like feathers, blood, or any other tissue of a species and then the CHD1 genes are amplified using PCR....
9 Pages (2250 words) Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us