StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...

Essays on extraction

The Extraction is one of the most popular assignments among students' documents. If you are stuck with writing or missing ideas, scroll down and find inspiration in the best samples. Extraction is quite a rare and popular topic for writing an essay, but it certainly is in our database.
Enter your email to get essay samples on your topic

Choose the best solution for you
Go through the list of samples
Go through the list of samples
SHOW SAMPLES
Order the paper
Order the paper
Writing Service

Oil Extraction in Russia

7 pages (2011 words)
Nobody downloaded yet
In the following paper “Oil Extraction in Russia” the author discusses challenges associated with oil production, which had since the past been attributed to environmental pollution with initial considerations attributed to environmental negligence…
Preview

Petroleum extraction process

4 pages (1000 words) , Download 2
Oil products like gasoline and diesel are used in transport as fossil fuel. Petroleum is a raw material for production of plastics and other organic compounds. Thus, petroleum industry combines…
Preview
sponsored ads
Hire a pro to write
a paper under your requirements!
Win a special DISCOUNT!
Put in your e-mail and click the button with your lucky finger
Your email
YOUR PRIZE:
Apply my DISCOUNT

New extraction technologies RAKAN

1 pages (250 words) , Download 1
Free
New energy extraction technologies are the processes that involve safe, efficient, environmental friendly and cost effective extraction of energy, its conversion to usable state, transportation, storage and subsequent use. The technology aims to be highly efficient and while…
Preview

Oil Exploration and Extraction

12 pages (3000 words) , Download 2
One of the greatest challenges of the present day that the humanity facing, is to provide every human being on the earth access to safe, clean and sustainable environment and energy supplies. The use of energy has been a critical issue throughout the history in the functioning and development of human societies…
Preview

Nigeria and Oil Extraction

8 pages (2000 words) , Download 1
In recent decades, environmental degradation has gotten quite out of hand, especially in Third World Countries, such as Nigeria. The main problem stems from the fact that there is no proper government control and no implementation of proper environmental problems…
Preview

Global Warming, Extraction and Exploration

6 pages (1500 words) , Download 1
The reporter states that petroleum business incorporates the worldwide procedures of oil exploration, extraction, refining, transporting regularly by oil tankers and pipelines, and promoting petroleum items. The biggest trade items in the industry are fuel oil and gas petrol…
Preview

Hazardous Wastes from Materials Extraction

3 pages (750 words) , Download 1
Name Instructor Course Date Hazardous Wastes from Materials Extraction Carbon Footprint and Environmental Impacts of Steel Refining, Aluminum Production and Plastic Carbon foot print is the sum of all greenhouse gases that a production process causes to the environment…
Preview

Extraction of Bacterial Chromosomal DNA

7 pages (1883 words) , Download 0
Free
In the following essay “Extraction of Bacterial Chromosomal DNA,” the author analyzes the bacterial cells burst, which opens at the initial point in the protocol when the barriers like cytoplasmic membrane and cell wall are disrupted by the enzyme lysozyme…
Preview

Protein Extraction and Gel Electrophoresis

5 pages (1250 words) , Download 4
This essay describes a report on an experiment conducted to determine the concentration of proteins in two samples using the Bradford assay and electrophoresis. It involved three steps, that is, protein extraction, protein quantitation, and gel electrophoresis of two samples…
Preview

Practical report on DNA Extraction Biological Science

4 pages (1000 words) , Download 1
Extraction of DNA from Kiwi fruit ABSTRACT Extraction of DNA from a Kiwi (Actinidia deliciosa) fruit was attempted using simple household items. The fruit was peeled, chopped and macerated with extraction buffer made from washing up liquid, salt and water…
Preview

Formation, Extraction and Transportation of Shale Oil

10 pages (3008 words) , Download 1
In the following paper “Formation, Extraction and Transportation of Shale Oil,” the author focuses on Cuadrilla Resources Ltd, which is a drilling company operating in Staffordshire, United Kingdom (UK). The company is founded in the year 2007…
Preview

Oil and Gas Extraction Accident

4 pages (1000 words) , Download 1
The paper examines the demand for the longlasting exploration of oil and gas which caused the detrimental effects on deepwater communities on continental shelves and seamounts and the aftermaths of the oil and gas accident for the British Petroleum company…
Preview

Extraction, Transformation and Load: Data Warehouse

8 pages (2000 words) , Download 1
The author of the paper gives detailed information about the ETL (Extraction, Transformation, and Loading) process of reshaping the data into useful information that is to be stored in a data warehouse. The data can only be vital and relevant if they are inconsistent and homogenous form. …
Preview

Development of a microfluidic device for extraction

12 pages (3000 words) , Download 2
Development of a microfluidic device for efficient protein extraction Eman Alzahrani* Department City * E-mail address: Abstract Sample pre-treatment is a required step in proteomics to remove interferences and concentrate the samples. A novel method to fabricate a continuous porous silica monolith inside a glass microchip and modify it with Octadecyl (C18) ligand was successfully developed…
Preview

Using Hydraulic Fracturing for Hydrocarbon Extraction

2 pages (500 words) , Download 1
Free
Hydraulic fracturing is a method gas and oil extraction by producing fractures in the rock formation that results into the flow of oil or natural gas thus enhances the volumes that can be recovered. In this method, wells are often drilled vertically thousands of feet below the…
Preview

Extraction of Metals from their Ores Worksheet

6 pages (1500 words) , Download 1
The exercise you are going to complete uses a collection of websites, data tables and charts to lead you through key ideas that you need to in order to understand the relationship between reactivity, price and extraction methods of different metals.
Used to make the alloy…
Preview

Impact of Petroluem Exploration, Extraction and Transport

9 pages (2779 words)
Nobody downloaded yet
"Impact of Petroleum Exploration, Extraction and Transport" paper discusses the potential environmental consequences of conventional drilling compared to Remote Manifold Platform drilling. The paper also discusses possible remediation techniques for restoring degraded land after drilling activity…
Preview

Impact of Petroleum Exploration, Extraction and Transport

7 pages (1750 words) , Download 1
The author of this report indicates the mitigation and disaster preparedness measures as well as the impacts of the Buncefield disaster. The Buncefield disaster occurred in December 2005 at the Burchfield Oil depot, which is located at Hertfordshire…
Preview

Impact of Oil Exploration, Extraction and Transport

9 pages (2500 words)
Nobody downloaded yet
"Impact of Oil Exploration, Extraction, and Transport" paper examines the dynamics of oil spillage, potential causes of the oil spillage at the Sankofa Project, how the Christmas tree function in the drilling process, and health and ecological impacts of oil spills. …
Preview

Preservation of the Environment in the Process of Oil Extraction

6 pages (1500 words)
Nobody downloaded yet
The author states that in order to curb the negative environmental impact of oil extraction, there are several initiatives, which can be put in place, and among these is the employment of satellite and other technologies before the beginning of the drilling process…
Preview

What is the role of sonication during protein extraction

1 pages (250 words) , Download 1
Free
Normally, the process of sonication comprises the use of ultrasound waves. In addition, a machine called a sonicator is effective in…
Preview

Analysis of Solutions to Drilling Problems in Oil Extraction

10 pages (2500 words) , Download 1
This paper addresses the drawbacks that are linked to drilling highlighting the effectiveness of underbalanced drilling and lost circulation materials as possible remedies to the problems. These include the overbalanced and underbalanced drilling processes…
Preview

DNA Extraction and PCR of Bird DNA for Sex Identification

9 pages (2699 words)
Nobody downloaded yet
The "DNA Extraction and PCR of Bird DNA for Sex Identification" paper aims to extract the DNA from the muscle, blood, and feather of Gallus gallus and to estimate the concentration of the DNA from the three samples and amplify the CHD1 gene using PCR…
Preview

Writing a protocol for genomic DNA extraction and PCR

4 pages (1000 words) , Download 2
10 μM stocks of Lambda primers, PC01: Forward-5’, GATGAGTTCGTGTCCGTACAACTGG, PC02: Reverse- 5’-GGTTATCGAAATCAGCCACAGCGCC-3’’, template: bacteriophage lambda DNA (0.3 μg/μL), Taq DNA polymerase (5U/μL), 10X Taq Amplification Buffer, dNTP mix (10 mM each of dATP,…
Preview

Information Extraction(Remote Sensing and Image Analysis)

2 pages (500 words) , Download 1
Free
“Remote Sensing in the most generally accepted meaning refers to instrument-based techniques employed in the acquisition and measurement of spatially organized (most commonly, geographically distributed) data/information on some property(ies) (spectral; spatial; physical) of…
Preview

Welding Operation and Evaluating the Effectiveness of Fume Extraction Guns

8 pages (2274 words) , Download 1
The author of the paper highlights that welding is a fabrication process helping in joining materials and metals. This is done by melting the metal or material and filling it with other materials to form the joint. Welding has been used by a number of industries across the world…
Preview

Impact of oil exploration, extraction and transport 2

7 pages (1750 words) , Download 1
In the United States, for instance, the time between 1970 and 1990 portrayed a time when there was no major issue concerning setting of…
Preview
EEG data preprocessing, prediction, feature extraction/selection and classification
5 pages (1250 words) , Download 2
RECENT PRACTICES IN EEG: CURRENT TRENDS AND RESEARCHES By [writer name] Presented to [department name] [college/university name] [date] EEG remains one of the most innovative technologies to understand the working of the brain through its neural activity and wave propagation…
Preview

Extraction of plasmid DNA and set up of polymerase chain Reaction (PCR)

5 pages (1250 words) , Download 3
It basically amplifies a particular gene by conducting an in vitro DNA replication. For this process to proceed, the necessary ingredients, such as the appropriate…
Preview
ETL (extraction/transformation/load) forms a crucial part in maintaining a data warehouse. Identify the typical problems that ET
7 pages (1750 words) , Download 1
ETL- Typical Problems, Critical Evaluation of Potential Solutions Table of Contents Introduction 3 ETL Overview 3 Typical ETL Problems 5 Evaluation of Potential Solutions 8 References 10 Introduction This paper explores the typical problems encountered in the extract-transformation-load or ETL process, and makes a critical evaluation of potential solutions to those problems…
Preview

Some botanists argue that in some cases the extraction of starch from sago palm is an easier alternative to traditional agricult

3 pages (750 words) , Download 1
(Name) (Professor) (Subject) (Date) Extraction of Starch from Sago Palm is an Easier Alternative to Traditional Agriculture: Answers to the Questions What was the purpose of Ellen’s research? What main conclusions were drawn?  The purpose of Ellen’s research is to “[demonstrate] how traditional sago palm has been used as a means of raising productivity [and to] examine the technological process of transforming sago pith into edible food” (Ellen)…
Preview
Nalytical Analysis of Anti-Depressants in Human Plasma Using Liquid-Liquid Chromatography
3 pages (750 words) , Download 1
Free
[Name of of Instructor] Antidepressants are drugs used for treating patients diagnosed with depression. Most antidepressants function by inhibiting the action of neurotransmitters using a range of mechanisms that target intermediate compounds…
Preview
Sustainability of Russian Platinum
7 pages (2223 words)
Nobody downloaded yet
The paper "Sustainability of Russian Platinum" states that the cost involved in using the bioleaching approach is significantly lower compared to the traditional methods. Thus, organizations involved in extracting platinum resources in Russia will save much cost by employing a bioleaching method…
Preview
Natural Resources and energy paper
2 pages (500 words) , Download 1
Free
Freshwater aquatic ecosystem is one of the forms of aquatic system providing highly useful energy resource for use which is the fresh water itself. Freshwater is exploited through its extraction…
Preview
Is the development of oilsands essential to Canadas future prosperity Give Pros and Cons
7 pages (1750 words) , Download 1
It also discusses the pros and the cons of Alberta’s oil sand. Through the discussion on the pros and cons of Alberta’s oil sands, the paper digs deeply into the economic…
Preview

Organic Chemistry

9 pages (2250 words) , Download 1
Extraction is one of the oldest chemical operations known to humankind. The preparation of a cup of coffee or tea involves the extraction of flavor and odor components from dried vegetable matter with hot water. Aqueous extracts of bay leaves, stick cinnamon, peppercorns, and cloves, along with alcoholic extracts of vanilla and almond, are used as food flavoring…
Preview
The Energy Information Administration (EIA)
1 pages (250 words) , Download 1
Free
According to Miller (247) tar sands are naturally occurring sands rich in bitumen, which produces mixtures of liquid hydrocarbon that is processed besides mechanical blending to yield finished petroleum products. It is abundantly found in Alberta in Canada, Congo Brazzaville,…
Preview
The Role of Corporate Social Responsibility Activities
10 pages (2682 words) , Download 1
The goal of this document "The Role of Corporate Social Responsibility Activities" is to lay out the problem statement, brief literature review and research roadmap for writing a dissertation that addresses the various issues in relation to the multinational investments in the extractive industries…
Preview
Interaction during a Supervisory Episode
6 pages (1500 words) , Download 1
In the paper “Interaction during a Supervisory Episode” the author analyzes trainer-trainee interactions in the actual practice of newly qualified health practitioners. The clinical setting is made up of numerous fields, all of which work to the best interest of the patients or clients…
Preview
The economics of Exhaustible Resources
14 pages (3500 words) , Download 1
It is the main concern of the following paper to establish whether it is viable to either extract or not the remaining exhaustible resources in the future considering the relevance of Harold Hotelling work in today’s world economic situation…
Preview
Biology 2 (plant and society)a
3 pages (750 words) , Download 1
Your Name Due Date Article Discussion: Sago Palm Starch Extraction 1)What was the purpose of Ellen’s research? What main conclusions were drawn? The overall intention of the author is to explain the purpose, process, technology, and other related factors, necessary to harvest sago palm starch as a substitute for cultivating it as a crop…
Preview
Will be clarified in the requirements
16 pages (4000 words) , Download 1
The project has been explained with reference to Schedule 1 & Schedule 2 of Town & Country Planning Regulation Act 2011. The environmental statement of the…
Preview
Cloning Brachyury from SW480 in pNEB193 plasmid
2 pages (500 words) , Download 2
Free
Hence, all the cells were removed and stored them in preparation for the RNA extraction. Examinations and recordings were done to examine if the cell count and cell morphology were allowed before the step of…
Preview
Abalytical Toxicology
8 pages (2000 words) , Download 1
Amphetamine and methamphetamine are powerful stimulants of the central nervous system.They are commonly used in pharmaceutical applications, either as metabolites of several therapeutic drugs or as such themselves. …
Preview
Procedure of the Principal Component Analysis
3 pages (901 words) , Download 1
This report provides a procedure of the principal component analysis in order to determine a factor affecting the export performance in the financial year. It describes the principal component analysis of factor analysis and VARIMAX rotation which were conducted. …
Preview
Assessment of a dry and a wet route for the production of biofuels from microalgae: Energy balance analysis
2 pages (500 words) , Download 2
Free
Microalgae release various high value by-products of metabolism that are useful in production of renewable energy when cultured on a large scale, especially due to its ability to develop completely closed algae to bio-fuel cycle. Microalgae are converted into energy both…
Preview
Use of forced eruption to enhance the Pontic site in the anterior maxilla
6 pages (1500 words) , Download 1
Over time, periodontics has metamormphisized in order to provide functional as well as aesthetic results for patients. For any periodontal therapy, the main objective is the restoration of the normal health of the periodontium…
Preview
Explanation of Why Natural Gas Is Found in the Formation
8 pages (2285 words) , Download 1
The author states that opposition to fracking activities in various parts has resulted in the employment of various public relations measures by companies. These efforts are geared towards the demystification of the fracking activities and processes…
Preview

Effects of the Alberta Tar Sands Development on the Environment

5 pages (1250 words) , Download 1
The chosen topic of this proposal is in how "eco-system effects in using steam for in-situ bitumen extraction wherein the process has a negative effect on the tailing ponds". Oil sand extraction in the Alberta Oil Sands located in northern Alberta relies on a method of cyclic steam stimulation and steam assisted gravity drainage in order to reach the in situ bitumen located more than four hundred metres below the earth's surface…
Preview
Individual Design Report
4 pages (1000 words) , Download 1
Title Page Acknowledgements Summary Statement of Design problem The focus of the paper is to create a design that will lessen the effects of salt water into the aquifer – that it, water extraction and at the same time, a remedy for the extent of salt water intrusion…
Preview
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.

Let us find you essays on topic Extraction for FREE!

Contact Us